Incidental Mutation 'R7879:Cic'
ID608637
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Namecapicua transcriptional repressor
Synonyms1200010B10Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25267704-25294159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25285126 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 996 (T996A)
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000165239] [ENSMUST00000169266]
Predicted Effect probably benign
Transcript: ENSMUST00000005578
AA Change: T89A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: T89A

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1155 N/A INTRINSIC
low complexity region 1223 1253 N/A INTRINSIC
low complexity region 1280 1313 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163320
AA Change: T89A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: T89A

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1064 1079 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
low complexity region 1134 1154 N/A INTRINSIC
low complexity region 1222 1252 N/A INTRINSIC
low complexity region 1279 1312 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165239
AA Change: T89A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: T89A

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 5e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169266
AA Change: T996A

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: T996A

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 25292124 missense probably damaging 1.00
IGL01668:Cic APN 7 25291204 missense possibly damaging 0.47
IGL02229:Cic APN 7 25290950 missense probably damaging 0.96
IGL02506:Cic APN 7 25290857 missense probably benign
IGL02794:Cic APN 7 25285644 missense probably damaging 1.00
IGL03065:Cic APN 7 25285821 splice site probably benign
IGL03304:Cic APN 7 25284849 missense probably damaging 1.00
Capuccino UTSW 7 25287140 missense probably damaging 0.98
Cassock UTSW 7 25288913 nonsense probably null
Monkey UTSW 7 25287141 missense probably damaging 1.00
1mM(1):Cic UTSW 7 25290789 splice site probably benign
IGL03046:Cic UTSW 7 25291075 missense probably damaging 1.00
R0012:Cic UTSW 7 25287140 missense probably damaging 0.98
R0012:Cic UTSW 7 25287141 missense probably damaging 1.00
R0027:Cic UTSW 7 25287140 missense probably damaging 0.98
R0027:Cic UTSW 7 25287141 missense probably damaging 1.00
R0038:Cic UTSW 7 25287140 missense probably damaging 0.98
R0038:Cic UTSW 7 25287141 missense probably damaging 1.00
R0063:Cic UTSW 7 25287140 missense probably damaging 0.98
R0063:Cic UTSW 7 25287141 missense probably damaging 1.00
R0064:Cic UTSW 7 25287140 missense probably damaging 0.98
R0064:Cic UTSW 7 25287141 missense probably damaging 1.00
R0118:Cic UTSW 7 25286034 missense probably damaging 1.00
R0193:Cic UTSW 7 25287140 missense probably damaging 0.98
R0193:Cic UTSW 7 25287141 missense probably damaging 1.00
R0241:Cic UTSW 7 25287140 missense probably damaging 0.98
R0241:Cic UTSW 7 25287141 missense probably damaging 1.00
R0377:Cic UTSW 7 25285799 missense probably damaging 0.98
R0462:Cic UTSW 7 25287140 missense probably damaging 0.98
R0462:Cic UTSW 7 25287141 missense probably damaging 1.00
R0800:Cic UTSW 7 25285237 missense probably benign
R1253:Cic UTSW 7 25290948 missense probably damaging 1.00
R1458:Cic UTSW 7 25279737 intron probably benign
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1519:Cic UTSW 7 25293810 critical splice acceptor site probably null
R1586:Cic UTSW 7 25285961 missense probably damaging 1.00
R1824:Cic UTSW 7 25288266 missense probably damaging 1.00
R1908:Cic UTSW 7 25286840 missense probably damaging 1.00
R2045:Cic UTSW 7 25271536 missense possibly damaging 0.53
R2063:Cic UTSW 7 25273451 missense probably damaging 0.98
R2161:Cic UTSW 7 25288134 splice site probably null
R2495:Cic UTSW 7 25291776 splice site probably benign
R2865:Cic UTSW 7 25273221 missense probably damaging 0.96
R3692:Cic UTSW 7 25288913 nonsense probably null
R3709:Cic UTSW 7 25286981 missense probably damaging 0.99
R3710:Cic UTSW 7 25286981 missense probably damaging 0.99
R3872:Cic UTSW 7 25271699 missense possibly damaging 0.92
R3946:Cic UTSW 7 25272346 missense possibly damaging 0.93
R4199:Cic UTSW 7 25291670 frame shift probably null
R4426:Cic UTSW 7 25294008 utr 3 prime probably benign
R4502:Cic UTSW 7 25288467 missense probably damaging 1.00
R4585:Cic UTSW 7 25272778 missense probably benign 0.33
R4586:Cic UTSW 7 25272778 missense probably benign 0.33
R4614:Cic UTSW 7 25291670 frame shift probably null
R4664:Cic UTSW 7 25290674 small deletion probably benign
R4688:Cic UTSW 7 25291670 frame shift probably null
R4695:Cic UTSW 7 25273588 missense possibly damaging 0.72
R4696:Cic UTSW 7 25288483 missense probably benign
R4746:Cic UTSW 7 25288480 missense probably damaging 1.00
R4758:Cic UTSW 7 25292211 missense possibly damaging 0.62
R4767:Cic UTSW 7 25271600 missense possibly damaging 0.92
R4776:Cic UTSW 7 25282883 missense possibly damaging 0.95
R4820:Cic UTSW 7 25271732 missense possibly damaging 0.92
R4850:Cic UTSW 7 25272902 missense probably damaging 0.98
R4851:Cic UTSW 7 25272902 missense probably damaging 0.98
R4922:Cic UTSW 7 25291670 small insertion probably benign
R4989:Cic UTSW 7 25287110 missense probably damaging 1.00
R5131:Cic UTSW 7 25291670 small insertion probably benign
R5718:Cic UTSW 7 25272778 missense probably benign 0.33
R5801:Cic UTSW 7 25271438 missense possibly damaging 0.93
R5949:Cic UTSW 7 25272305 missense probably damaging 1.00
R6000:Cic UTSW 7 25271998 missense probably benign 0.33
R6246:Cic UTSW 7 25271642 missense probably damaging 1.00
R6283:Cic UTSW 7 25286034 missense probably damaging 1.00
R6364:Cic UTSW 7 25272823 missense possibly damaging 0.72
R6481:Cic UTSW 7 25288281 missense possibly damaging 0.56
R6919:Cic UTSW 7 25271777 missense probably benign 0.04
R6920:Cic UTSW 7 25290682 missense probably damaging 1.00
R6995:Cic UTSW 7 25271311 missense possibly damaging 0.53
R7002:Cic UTSW 7 25272196 missense probably damaging 0.99
R7113:Cic UTSW 7 25273444 missense probably benign 0.08
R7560:Cic UTSW 7 25272853 missense probably damaging 0.98
R7680:Cic UTSW 7 25292431 missense probably damaging 0.96
R7698:Cic UTSW 7 25273172 missense possibly damaging 0.72
R7746:Cic UTSW 7 25288782 missense probably damaging 1.00
R7841:Cic UTSW 7 25285767 missense probably damaging 1.00
R7916:Cic UTSW 7 25288290 missense probably damaging 0.99
R7920:Cic UTSW 7 25271959 missense probably benign
R8056:Cic UTSW 7 25290941 missense possibly damaging 0.90
R8226:Cic UTSW 7 25287788 missense probably damaging 1.00
R8281:Cic UTSW 7 25271824 missense probably benign
V7732:Cic UTSW 7 25292245 missense probably benign
Z1176:Cic UTSW 7 25271019 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGTCGAACCTCGTTCTGTGG -3'
(R):5'- GATCACTCTCGGTCTCACTG -3'

Sequencing Primer
(F):5'- CTCTGTGCAGCCTAGTGAG -3'
(R):5'- TCTCACTGTCCAGCCGG -3'
Posted On2019-12-20