Incidental Mutation 'R7879:Polg'
ID608638
Institutional Source Beutler Lab
Gene Symbol Polg
Ensembl Gene ENSMUSG00000039176
Gene Namepolymerase (DNA directed), gamma
SynonymsPol gamma, Polga, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, polymerase gamma
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79446231-79466362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79450644 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1140 (C1140S)
Ref Sequence ENSEMBL: ENSMUSP00000073551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036865] [ENSMUST00000073889] [ENSMUST00000132048] [ENSMUST00000132091] [ENSMUST00000139290] [ENSMUST00000149444] [ENSMUST00000201907]
Predicted Effect probably benign
Transcript: ENSMUST00000036865
SMART Domains Protein: ENSMUSP00000044931
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 7.5e-27 PFAM
Pfam:FANCI_S1 62 280 3.5e-78 PFAM
Pfam:FANCI_HD1 284 370 1.6e-37 PFAM
Pfam:FANCI_S2 378 540 2.4e-63 PFAM
Pfam:FANCI_HD2 554 785 4.8e-87 PFAM
Pfam:FANCI_S3 803 1028 1.7e-83 PFAM
Pfam:FANCI_S4 1041 1295 1.3e-95 PFAM
low complexity region 1299 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073889
AA Change: C1140S

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176
AA Change: C1140S

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132048
SMART Domains Protein: ENSMUSP00000143933
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 203 2e-71 PDB
SCOP:d1qm9a1 76 122 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132091
SMART Domains Protein: ENSMUSP00000122113
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 1.6e-29 PFAM
Pfam:FANCI_S1 60 281 3.2e-81 PFAM
Pfam:FANCI_HD1 284 371 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139290
SMART Domains Protein: ENSMUSP00000144035
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 1 69 2e-41 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000139668
SMART Domains Protein: ENSMUSP00000114414
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
PDB:3IKM|D 13 236 1e-125 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000149444
SMART Domains Protein: ENSMUSP00000119616
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 490 N/A PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201030
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000201907
SMART Domains Protein: ENSMUSP00000144084
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
Blast:POLAc 1 49 4e-24 BLAST
PDB:3IKM|D 1 50 6e-24 PDB
SCOP:d1t7pa2 21 49 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206121
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous proof-reading deficient mutants display reduced life spans and premature aging with weight loss, decreased subcutaneous fat, alopecia, kyphosis, osteoporosis, anemia, reduced fertility, and enlarged hearts. Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Polg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Polg APN 7 79451925 missense probably damaging 1.00
IGL00970:Polg APN 7 79451745 missense probably benign 0.01
IGL01883:Polg APN 7 79458318 missense probably damaging 1.00
IGL02124:Polg APN 7 79459737 missense probably damaging 1.00
IGL02127:Polg APN 7 79458167 unclassified probably benign
IGL02820:Polg APN 7 79459771 missense possibly damaging 0.92
IGL03075:Polg APN 7 79451912 missense probably damaging 1.00
IGL03180:Polg APN 7 79451853 splice site probably benign
IGL03198:Polg APN 7 79451722 missense probably damaging 1.00
IGL03222:Polg APN 7 79454656 missense probably damaging 0.98
R0030:Polg UTSW 7 79452128 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0416:Polg UTSW 7 79452240 unclassified probably benign
R0522:Polg UTSW 7 79460151 splice site probably benign
R0638:Polg UTSW 7 79460148 splice site probably benign
R1263:Polg UTSW 7 79459786 missense probably benign
R1831:Polg UTSW 7 79459770 missense probably benign 0.41
R1873:Polg UTSW 7 79456493 missense probably benign 0.04
R1906:Polg UTSW 7 79460322 missense probably damaging 1.00
R1997:Polg UTSW 7 79459231 missense probably damaging 1.00
R2127:Polg UTSW 7 79464928 missense probably damaging 1.00
R2155:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2156:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2173:Polg UTSW 7 79455593 missense probably damaging 0.99
R3720:Polg UTSW 7 79456791 nonsense probably null
R4082:Polg UTSW 7 79464828 missense probably damaging 1.00
R4127:Polg UTSW 7 79455537 missense probably damaging 1.00
R4510:Polg UTSW 7 79455522 missense probably benign 0.01
R4511:Polg UTSW 7 79455522 missense probably benign 0.01
R4571:Polg UTSW 7 79460379 missense probably damaging 1.00
R4888:Polg UTSW 7 79464605 missense probably damaging 1.00
R5008:Polg UTSW 7 79460074 missense probably damaging 1.00
R5095:Polg UTSW 7 79460300 missense possibly damaging 0.92
R5121:Polg UTSW 7 79464605 missense probably damaging 1.00
R5139:Polg UTSW 7 79450025 missense probably damaging 1.00
R5213:Polg UTSW 7 79454098 missense probably damaging 1.00
R5285:Polg UTSW 7 79465225 utr 5 prime probably benign
R5498:Polg UTSW 7 79454670 missense probably damaging 1.00
R5714:Polg UTSW 7 79451991 missense possibly damaging 0.53
R5940:Polg UTSW 7 79454071 missense possibly damaging 0.95
R6146:Polg UTSW 7 79450512 missense probably benign 0.02
R6754:Polg UTSW 7 79459836 missense probably damaging 1.00
R6791:Polg UTSW 7 79460109 missense probably benign 0.25
R6829:Polg UTSW 7 79460109 missense probably benign 0.25
R6913:Polg UTSW 7 79460657 missense probably damaging 0.97
R7644:Polg UTSW 7 79451668 missense probably damaging 1.00
R8174:Polg UTSW 7 79456718 missense probably benign 0.10
Z1176:Polg UTSW 7 79453741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAGGTTCTAAGCTACTTCCC -3'
(R):5'- GTGTTGAGTCCCTAATTGTATCTCAG -3'

Sequencing Primer
(F):5'- TCCCATTCTACATGTAGAGGGAAC -3'
(R):5'- CTCAGTATCTCAGAGGTATTAGGC -3'
Posted On2019-12-20