Incidental Mutation 'R7879:Chrna6'
ID608642
Institutional Source Beutler Lab
Gene Symbol Chrna6
Ensembl Gene ENSMUSG00000031491
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 6
SynonymsAcra6, alpha6 nAChR
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location27403212-27413944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27407081 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 256 (F256S)
Ref Sequence ENSEMBL: ENSMUSP00000033882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033882]
Predicted Effect probably damaging
Transcript: ENSMUST00000033882
AA Change: F256S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033882
Gene: ENSMUSG00000031491
AA Change: F256S

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 34 240 1.7e-78 PFAM
Pfam:Neur_chan_memb 247 483 1.2e-89 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha subunit of neuronal nicotinic acetylcholine receptors. These receptors consist of five subunits and function as ion channels involved in neurotransmission. The encoded protein is a subunit of neuronal nicotinic acetylcholine receptors that mediate dopaminergic neurotransmission and are activated by acetylcholine and exogenous nicotine. Alternatively spliced transcript variants have been observed for this gene. Single nucleotide polymorphisms in this gene have been associated with both nicotine and alcohol dependence. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homzygous mutant animals have decreased numbers of high affinity binding sites for [3H]nicotine, [3H]epibaditine, and [3H]cytisine in the terminal region of the retinal ganglion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Chrna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Chrna6 APN 8 27406532 missense probably damaging 1.00
IGL02040:Chrna6 APN 8 27407261 missense probably damaging 0.99
IGL02067:Chrna6 APN 8 27404396 missense probably damaging 1.00
IGL02674:Chrna6 APN 8 27406851 missense probably benign 0.00
IGL03011:Chrna6 APN 8 27413654 missense possibly damaging 0.48
R0087:Chrna6 UTSW 8 27406986 missense probably damaging 1.00
R0421:Chrna6 UTSW 8 27408387 missense probably null 0.98
R0786:Chrna6 UTSW 8 27408380 missense probably benign 0.26
R1784:Chrna6 UTSW 8 27406784 missense possibly damaging 0.60
R1834:Chrna6 UTSW 8 27407214 missense probably benign 0.04
R2087:Chrna6 UTSW 8 27407127 missense probably benign 0.00
R4545:Chrna6 UTSW 8 27406683 missense probably benign
R4785:Chrna6 UTSW 8 27407106 missense probably damaging 1.00
R5621:Chrna6 UTSW 8 27407040 missense probably damaging 1.00
R6002:Chrna6 UTSW 8 27406746 missense probably benign 0.03
R6834:Chrna6 UTSW 8 27408310 splice site probably null
R6937:Chrna6 UTSW 8 27407027 missense probably damaging 1.00
R6968:Chrna6 UTSW 8 27406655 missense probably benign 0.01
R7303:Chrna6 UTSW 8 27406991 nonsense probably null
R7319:Chrna6 UTSW 8 27406787 missense possibly damaging 0.58
R7775:Chrna6 UTSW 8 27407364 missense probably damaging 1.00
R7778:Chrna6 UTSW 8 27407364 missense probably damaging 1.00
R7824:Chrna6 UTSW 8 27407364 missense probably damaging 1.00
R8100:Chrna6 UTSW 8 27413816 start gained probably benign
R8292:Chrna6 UTSW 8 27406726 missense probably benign 0.05
Z1177:Chrna6 UTSW 8 27413689 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGACAGCGTGACAAAGATC -3'
(R):5'- AGGCAGAAATCGACCTTCTCATC -3'

Sequencing Primer
(F):5'- TCATGGTGAACAGTAGATACTCACC -3'
(R):5'- GCAGAAATCGACCTTCTCATCATTGG -3'
Posted On2019-12-20