Incidental Mutation 'R7879:Npy5r'
ID608643
Institutional Source Beutler Lab
Gene Symbol Npy5r
Ensembl Gene ENSMUSG00000044014
Gene Nameneuropeptide Y receptor Y5
SynonymsY5R
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location66679965-66688128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66681316 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 275 (M275T)
Ref Sequence ENSEMBL: ENSMUSP00000065157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070810] [ENSMUST00000211920] [ENSMUST00000212563]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070810
AA Change: M275T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065157
Gene: ENSMUSG00000044014
AA Change: M275T

DomainStartEndE-ValueType
internal_repeat_1 15 36 1.53e-7 PROSPERO
internal_repeat_1 36 57 1.53e-7 PROSPERO
Pfam:7TM_GPCR_Srsx 73 253 1.9e-10 PFAM
Pfam:7tm_1 79 445 2.9e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211920
AA Change: M275T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212563
AA Change: M275T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for neuropeptide Y and peptide YY. The encoded protein appears to be involved in regulating food intake, with defects in this gene being associated with eating disorders. Also, the encoded protein is involved in a pathway that protects neuroblastoma cells from chemotherapy-induced cell death, providing a possible therapeutic target against neuroblastoma. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show increased susceptibility to diet-induced obesity and a reduced orexigenic response to select agonists. Homozygotes for a reporter allele show mild late-onset obesity, increased adiposity, polyphagia, and exacerbated obesity parameters after chronic NPY infusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Npy5r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Npy5r APN 8 66681866 missense possibly damaging 0.47
IGL02192:Npy5r APN 8 66681346 missense probably benign 0.02
oleo UTSW 8 66682041 nonsense probably null
roly-poly UTSW 8 66681540 frame shift probably null
R0395:Npy5r UTSW 8 66681973 missense probably benign 0.21
R1547:Npy5r UTSW 8 66681034 missense possibly damaging 0.52
R1616:Npy5r UTSW 8 66681400 missense probably damaging 1.00
R1906:Npy5r UTSW 8 66681473 missense probably damaging 1.00
R1965:Npy5r UTSW 8 66681277 missense probably benign
R2443:Npy5r UTSW 8 66681290 nonsense probably null
R4087:Npy5r UTSW 8 66682045 missense probably damaging 0.98
R4204:Npy5r UTSW 8 66682041 nonsense probably null
R4404:Npy5r UTSW 8 66681992 missense probably benign 0.01
R5427:Npy5r UTSW 8 66681020 missense probably damaging 0.98
R5530:Npy5r UTSW 8 66680860 missense probably benign 0.06
R5994:Npy5r UTSW 8 66682099 missense probably benign 0.06
R6041:Npy5r UTSW 8 66682023 missense possibly damaging 0.72
R6602:Npy5r UTSW 8 66681540 frame shift probably null
R6837:Npy5r UTSW 8 66681740 missense probably benign 0.00
R7923:Npy5r UTSW 8 66681752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACGGTTAGGTGCTTCTCC -3'
(R):5'- ACAGCCTTGTGGAACTTAAGG -3'

Sequencing Primer
(F):5'- CTTCTCCTGGGAAGGTCCTG -3'
(R):5'- CTTAAGGAAACCTTTGGCTCAGC -3'
Posted On2019-12-20