Incidental Mutation 'R7879:Sema7a'
ID608646
Institutional Source Beutler Lab
Gene Symbol Sema7a
Ensembl Gene ENSMUSG00000038264
Gene Namesema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A
SynonymsCDw108, Semal, 2900057C09Rik, Semaphorin K1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location57940112-57962865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57955080 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 189 (I189F)
Ref Sequence ENSEMBL: ENSMUSP00000042211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043059] [ENSMUST00000214314]
Predicted Effect probably damaging
Transcript: ENSMUST00000043059
AA Change: I189F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042211
Gene: ENSMUSG00000038264
AA Change: I189F

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Sema 72 472 4.11e-119 SMART
PSI 490 540 7.64e-9 SMART
IG 549 630 3.63e-1 SMART
transmembrane domain 644 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214314
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of proteins. The encoded preproprotein is proteolytically processed to generate the mature glycosylphosphatidylinositol (GPI)-anchored membrane glycoprotein. The encoded protein is found on activated lymphocytes and erythrocytes and may be involved in immunomodulatory and neuronal processes. The encoded protein carries the John Milton Hagen (JMH) blood group antigens. Mutations in this gene may be associated with reduced bone mineral density (BMD). Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: The development of the olfactory tract is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Sema7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Sema7a APN 9 57955838 missense probably damaging 1.00
IGL01967:Sema7a APN 9 57956395 missense probably damaging 1.00
IGL02030:Sema7a APN 9 57955140 missense possibly damaging 0.91
IGL02031:Sema7a APN 9 57955140 missense possibly damaging 0.91
IGL02115:Sema7a APN 9 57960900 missense probably damaging 1.00
IGL02203:Sema7a APN 9 57957606 missense probably benign
IGL02808:Sema7a APN 9 57960348 missense probably benign 0.25
R0531:Sema7a UTSW 9 57960593 missense possibly damaging 0.95
R1603:Sema7a UTSW 9 57960676 missense probably benign 0.18
R1845:Sema7a UTSW 9 57954899 missense possibly damaging 0.65
R4598:Sema7a UTSW 9 57953551 missense probably benign 0.04
R4903:Sema7a UTSW 9 57955095 missense probably benign 0.00
R4954:Sema7a UTSW 9 57956380 missense probably damaging 1.00
R5172:Sema7a UTSW 9 57957678 missense probably benign 0.02
R5514:Sema7a UTSW 9 57955763 missense probably damaging 1.00
R5618:Sema7a UTSW 9 57960283 missense possibly damaging 0.71
R5652:Sema7a UTSW 9 57960659 missense probably damaging 1.00
R5793:Sema7a UTSW 9 57960257 missense probably damaging 0.98
R6365:Sema7a UTSW 9 57954905 missense probably benign 0.31
R6736:Sema7a UTSW 9 57960571 missense probably damaging 1.00
R6822:Sema7a UTSW 9 57960336 missense probably damaging 1.00
R6829:Sema7a UTSW 9 57960898 missense probably benign 0.00
R7380:Sema7a UTSW 9 57961564 missense unknown
R7381:Sema7a UTSW 9 57953569 missense probably benign 0.00
R7467:Sema7a UTSW 9 57961422 missense probably damaging 1.00
R7593:Sema7a UTSW 9 57960575 missense probably benign 0.06
R7601:Sema7a UTSW 9 57940277 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACTCCCTGGTTCTGTTTGAAG -3'
(R):5'- AGCTGACTGTTCAGATTTGTGC -3'

Sequencing Primer
(F):5'- CTGTTTGAAGGTAGAACAGCATTG -3'
(R):5'- GGAAGTCCTCCTGGCACACATC -3'
Posted On2019-12-20