Incidental Mutation 'R7879:Slc22a8'
ID608670
Institutional Source Beutler Lab
Gene Symbol Slc22a8
Ensembl Gene ENSMUSG00000063796
Gene Namesolute carrier family 22 (organic anion transporter), member 8
SynonymsRoct, mOat3, OAT3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8591254-8611834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8594022 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 39 (I39T)
Ref Sequence ENSEMBL: ENSMUSP00000010251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010251] [ENSMUST00000170817]
Predicted Effect probably benign
Transcript: ENSMUST00000010251
AA Change: I39T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000010251
Gene: ENSMUSG00000063796
AA Change: I39T

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:Sugar_tr 73 506 6.8e-33 PFAM
Pfam:MFS_1 97 461 6.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170817
AA Change: I39T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131045
Gene: ENSMUSG00000063796
AA Change: I39T

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:Sugar_tr 78 507 6.7e-34 PFAM
Pfam:MFS_1 97 461 6.8e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased urinary urate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Slc22a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Slc22a8 APN 19 8594135 missense probably benign 0.37
IGL00679:Slc22a8 APN 19 8604855 missense possibly damaging 0.54
IGL00717:Slc22a8 APN 19 8609929 missense probably benign 0.02
IGL00974:Slc22a8 APN 19 8609926 missense probably damaging 1.00
IGL01104:Slc22a8 APN 19 8607965 missense possibly damaging 0.62
IGL01975:Slc22a8 APN 19 8605411 missense probably damaging 0.96
IGL02025:Slc22a8 APN 19 8594175 missense possibly damaging 0.65
IGL02353:Slc22a8 APN 19 8608255 missense possibly damaging 0.78
IGL02360:Slc22a8 APN 19 8608255 missense possibly damaging 0.78
IGL02535:Slc22a8 APN 19 8610203 missense probably benign
IGL02639:Slc22a8 APN 19 8593959 missense probably benign
IGL03167:Slc22a8 APN 19 8609958 missense probably damaging 1.00
IGL03368:Slc22a8 APN 19 8609119 splice site probably benign
R0333:Slc22a8 UTSW 19 8608150 splice site probably benign
R1290:Slc22a8 UTSW 19 8609911 missense probably damaging 1.00
R1773:Slc22a8 UTSW 19 8594229 missense probably damaging 1.00
R1861:Slc22a8 UTSW 19 8606139 missense probably damaging 1.00
R2516:Slc22a8 UTSW 19 8610195 missense probably benign
R2988:Slc22a8 UTSW 19 8610248 missense probably benign 0.00
R3914:Slc22a8 UTSW 19 8608186 missense probably damaging 1.00
R4206:Slc22a8 UTSW 19 8608233 missense probably benign 0.00
R5092:Slc22a8 UTSW 19 8594164 missense probably damaging 1.00
R5463:Slc22a8 UTSW 19 8609274 missense probably benign 0.00
R5470:Slc22a8 UTSW 19 8607870 missense probably damaging 1.00
R6733:Slc22a8 UTSW 19 8609292 missense probably benign 0.01
R7009:Slc22a8 UTSW 19 8605417 missense probably benign 0.05
R7642:Slc22a8 UTSW 19 8610045 missense probably benign 0.00
R7684:Slc22a8 UTSW 19 8609930 missense probably benign 0.00
R7689:Slc22a8 UTSW 19 8607884 missense probably damaging 0.96
R7729:Slc22a8 UTSW 19 8593959 missense possibly damaging 0.95
R8030:Slc22a8 UTSW 19 8610007 missense probably damaging 0.99
R8113:Slc22a8 UTSW 19 8605539 missense probably benign 0.00
R8280:Slc22a8 UTSW 19 8609263 nonsense probably null
Z1176:Slc22a8 UTSW 19 8593922 missense probably benign 0.10
Z1177:Slc22a8 UTSW 19 8605423 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATGATGCTCCACAGGCCTAC -3'
(R):5'- GTAGATCCAGCCATCCAAGCATG -3'

Sequencing Primer
(F):5'- TGCTCCACAGGCCTACATACAATTC -3'
(R):5'- AAGCATGGCTCGGTGGC -3'
Posted On2019-12-20