Incidental Mutation 'R7880:Taf4'
ID608682
Institutional Source Beutler Lab
Gene Symbol Taf4
Ensembl Gene ENSMUSG00000039117
Gene NameTATA-box binding protein associated factor 4
SynonymsTaf4a, Taf2c1, TAFII130, TAFII135
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7880 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location179912152-179976646 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 179935933 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 532 (R532*)
Ref Sequence ENSEMBL: ENSMUSP00000038610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041618] [ENSMUST00000227325]
Predicted Effect probably null
Transcript: ENSMUST00000041618
AA Change: R532*
SMART Domains Protein: ENSMUSP00000038610
Gene: ENSMUSG00000039117
AA Change: R532*

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 64 181 N/A INTRINSIC
SCOP:d1hqva_ 312 325 6e-3 SMART
low complexity region 339 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
internal_repeat_1 465 500 2.85e-5 PROSPERO
low complexity region 537 547 N/A INTRINSIC
TAFH 550 642 4.9e-54 SMART
internal_repeat_1 692 727 2.85e-5 PROSPERO
low complexity region 767 773 N/A INTRINSIC
Pfam:TAF4 791 1039 3.5e-81 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000227325
AA Change: R532*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that has been shown to potentiate transcriptional activation by retinoic acid, thyroid hormone and vitamin D3 receptors. In addition, this subunit interacts with the transcription factor CREB, which has a glutamine-rich activation domain, and binds to other proteins containing glutamine-rich regions. Aberrant binding to this subunit by proteins with expanded polyglutamine regions has been suggested as one of the pathogenetic mechanisms underlying a group of neurodegenerative disorders referred to as polyglutamine diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletions of this marker die embryonically sometime around E9.5. Conditional expression of this allele in the epidermis causes skin barrier defects and defects in hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,909,962 D703V possibly damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Akap13 A G 7: 75,586,216 T180A probably damaging Het
Arhgap31 G A 16: 38,602,725 A993V probably benign Het
Asxl3 C T 18: 22,522,151 P1073S possibly damaging Het
Bmp3 T G 5: 98,872,575 S286A probably damaging Het
Cacna2d4 C T 6: 119,349,155 S1078F probably damaging Het
Cd101 A G 3: 101,007,866 L799P probably benign Het
Chst13 C T 6: 90,325,080 R28H possibly damaging Het
CN725425 T A 15: 91,246,105 C390* probably null Het
Crabp1 C A 9: 54,765,658 C82* probably null Het
Cyp2b23 A C 7: 26,673,134 V352G probably damaging Het
Dmrta1 T A 4: 89,688,844 V179E possibly damaging Het
Ect2l T C 10: 18,136,954 D839G possibly damaging Het
Espnl A T 1: 91,344,766 E616V possibly damaging Het
Fam50b C A 13: 34,746,819 Q93K probably benign Het
Focad C T 4: 88,401,170 R1539C unknown Het
Gm14443 T A 2: 175,169,370 I428L probably benign Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm7030 T A 17: 36,127,869 H210L possibly damaging Het
Gramd1c C G 16: 43,992,076 A193P probably benign Het
Gsn A G 2: 35,283,927 H54R probably damaging Het
Gucy2g T A 19: 55,206,280 I902F probably damaging Het
Heg1 T C 16: 33,719,509 S280P possibly damaging Het
Herc1 G T 9: 66,508,224 R4827L probably damaging Het
Igsf21 A G 4: 140,157,508 C46R probably damaging Het
Kansl1 G T 11: 104,424,153 A353D probably damaging Het
Kcnab3 A G 11: 69,331,464 Y311C probably damaging Het
Kctd18 A G 1: 57,967,619 I24T possibly damaging Het
Lpcat4 C A 2: 112,240,031 H30N probably benign Het
Lrrc4c A G 2: 97,630,798 I590V probably benign Het
Lrrc69 T C 4: 14,703,946 I291M possibly damaging Het
Nsun6 A C 2: 14,996,379 C455W probably damaging Het
Olfr1112 T A 2: 87,192,090 C134* probably null Het
Olfr1264 A T 2: 90,022,037 F10I probably damaging Het
Olfr832 T G 9: 18,944,728 L27V probably benign Het
Olfr992 G T 2: 85,400,035 S166Y possibly damaging Het
Orc6 T C 8: 85,305,244 I162T probably benign Het
Pex13 A T 11: 23,649,369 S381T probably benign Het
Ppil1 G A 17: 29,261,788 H54Y probably damaging Het
Prrt4 T C 6: 29,170,156 I766V probably benign Het
Rab32 C T 10: 10,546,415 V187M probably damaging Het
Sema5a T A 15: 32,686,808 I1022N probably damaging Het
Sipa1l2 T C 8: 125,464,393 T953A probably damaging Het
Snapc3 T C 4: 83,435,194 S157P probably damaging Het
Spink5 A G 18: 43,986,326 R235G probably benign Het
Stx5a G A 19: 8,742,328 G19D probably damaging Het
Tmpo T A 10: 91,166,030 K106* probably null Het
Trnt1 T C 6: 106,769,556 probably null Het
Vmn1r228 A T 17: 20,776,410 I282N probably damaging Het
Vps13d A T 4: 145,181,114 probably null Het
Zfp703 A G 8: 26,978,690 I51V unknown Het
Zfp787 A G 7: 6,132,191 F354L probably benign Het
Znrf2 T C 6: 54,817,347 V111A probably benign Het
Zwint G T 10: 72,657,092 R182L probably benign Het
Other mutations in Taf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Taf4 APN 2 179976625 missense unknown
IGL00517:Taf4 APN 2 179924413 splice site probably benign
IGL02159:Taf4 APN 2 179938470 missense probably benign 0.24
IGL02254:Taf4 APN 2 179921184 missense probably benign 0.25
IGL03366:Taf4 APN 2 179935054 missense probably damaging 1.00
R0049:Taf4 UTSW 2 179924091 missense probably damaging 0.98
R0049:Taf4 UTSW 2 179924091 missense probably damaging 0.98
R1267:Taf4 UTSW 2 179929324 missense possibly damaging 0.46
R1495:Taf4 UTSW 2 179933027 missense probably damaging 1.00
R1560:Taf4 UTSW 2 179935953 missense probably benign 0.14
R1756:Taf4 UTSW 2 179976531 missense unknown
R1893:Taf4 UTSW 2 179933030 missense probably damaging 0.98
R1932:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R2213:Taf4 UTSW 2 179935890 critical splice donor site probably null
R3896:Taf4 UTSW 2 179932014 missense probably benign 0.45
R4050:Taf4 UTSW 2 179932012 missense probably damaging 1.00
R4448:Taf4 UTSW 2 179935971 missense possibly damaging 0.65
R4736:Taf4 UTSW 2 179924494 missense probably damaging 1.00
R5124:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R6155:Taf4 UTSW 2 179913524 missense probably damaging 1.00
R6238:Taf4 UTSW 2 179932039 missense probably damaging 0.97
R6292:Taf4 UTSW 2 179923987 missense probably damaging 1.00
R7749:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7751:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7752:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7754:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7835:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7879:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7880:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7883:Taf4 UTSW 2 179929295 missense probably damaging 1.00
R7899:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7902:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7905:Taf4 UTSW 2 179932029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTGCAGGTCACCCCATAAG -3'
(R):5'- GCCCTTGTTGAGCCATTTG -3'

Sequencing Primer
(F):5'- CACGTGGGTCCCTTCAATG -3'
(R):5'- GCTCCCTACGTTTTCAGAAGCTG -3'
Posted On2019-12-20