Incidental Mutation 'R7880:Cyp2b23'
ID608697
Institutional Source Beutler Lab
Gene Symbol Cyp2b23
Ensembl Gene ENSMUSG00000040650
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 23
SynonymsEG243881
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7880 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location26665227-26686437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 26673134 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 352 (V352G)
Ref Sequence ENSEMBL: ENSMUSP00000076578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077356]
Predicted Effect probably damaging
Transcript: ENSMUST00000077356
AA Change: V352G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076578
Gene: ENSMUSG00000040650
AA Change: V352G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 488 2.9e-148 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,909,962 D703V possibly damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Akap13 A G 7: 75,586,216 T180A probably damaging Het
Arhgap31 G A 16: 38,602,725 A993V probably benign Het
Asxl3 C T 18: 22,522,151 P1073S possibly damaging Het
Bmp3 T G 5: 98,872,575 S286A probably damaging Het
Cacna2d4 C T 6: 119,349,155 S1078F probably damaging Het
Cd101 A G 3: 101,007,866 L799P probably benign Het
Chst13 C T 6: 90,325,080 R28H possibly damaging Het
CN725425 T A 15: 91,246,105 C390* probably null Het
Crabp1 C A 9: 54,765,658 C82* probably null Het
Dmrta1 T A 4: 89,688,844 V179E possibly damaging Het
Ect2l T C 10: 18,136,954 D839G possibly damaging Het
Espnl A T 1: 91,344,766 E616V possibly damaging Het
Fam50b C A 13: 34,746,819 Q93K probably benign Het
Focad C T 4: 88,401,170 R1539C unknown Het
Gm14443 T A 2: 175,169,370 I428L probably benign Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm7030 T A 17: 36,127,869 H210L possibly damaging Het
Gramd1c C G 16: 43,992,076 A193P probably benign Het
Gsn A G 2: 35,283,927 H54R probably damaging Het
Gucy2g T A 19: 55,206,280 I902F probably damaging Het
Heg1 T C 16: 33,719,509 S280P possibly damaging Het
Herc1 G T 9: 66,508,224 R4827L probably damaging Het
Igsf21 A G 4: 140,157,508 C46R probably damaging Het
Kansl1 G T 11: 104,424,153 A353D probably damaging Het
Kcnab3 A G 11: 69,331,464 Y311C probably damaging Het
Kctd18 A G 1: 57,967,619 I24T possibly damaging Het
Lpcat4 C A 2: 112,240,031 H30N probably benign Het
Lrrc4c A G 2: 97,630,798 I590V probably benign Het
Lrrc69 T C 4: 14,703,946 I291M possibly damaging Het
Nsun6 A C 2: 14,996,379 C455W probably damaging Het
Olfr1112 T A 2: 87,192,090 C134* probably null Het
Olfr1264 A T 2: 90,022,037 F10I probably damaging Het
Olfr832 T G 9: 18,944,728 L27V probably benign Het
Olfr992 G T 2: 85,400,035 S166Y possibly damaging Het
Orc6 T C 8: 85,305,244 I162T probably benign Het
Pex13 A T 11: 23,649,369 S381T probably benign Het
Ppil1 G A 17: 29,261,788 H54Y probably damaging Het
Prrt4 T C 6: 29,170,156 I766V probably benign Het
Rab32 C T 10: 10,546,415 V187M probably damaging Het
Sema5a T A 15: 32,686,808 I1022N probably damaging Het
Sipa1l2 T C 8: 125,464,393 T953A probably damaging Het
Snapc3 T C 4: 83,435,194 S157P probably damaging Het
Spink5 A G 18: 43,986,326 R235G probably benign Het
Stx5a G A 19: 8,742,328 G19D probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Taf4 G A 2: 179,935,933 R532* probably null Het
Tmpo T A 10: 91,166,030 K106* probably null Het
Trnt1 T C 6: 106,769,556 probably null Het
Vmn1r228 A T 17: 20,776,410 I282N probably damaging Het
Vps13d A T 4: 145,181,114 probably null Het
Zfp703 A G 8: 26,978,690 I51V unknown Het
Zfp787 A G 7: 6,132,191 F354L probably benign Het
Znrf2 T C 6: 54,817,347 V111A probably benign Het
Zwint G T 10: 72,657,092 R182L probably benign Het
Other mutations in Cyp2b23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Cyp2b23 APN 7 26679490 missense probably damaging 0.98
IGL01879:Cyp2b23 APN 7 26672854 missense probably benign 0.04
IGL02207:Cyp2b23 APN 7 26681755 missense probably damaging 1.00
IGL03047:Cyp2b23 APN 7 26681467 splice site probably benign
R0117:Cyp2b23 UTSW 7 26673114 missense probably benign 0.25
R0265:Cyp2b23 UTSW 7 26672879 splice site probably benign
R1457:Cyp2b23 UTSW 7 26673149 missense probably damaging 1.00
R1605:Cyp2b23 UTSW 7 26686418 missense probably benign 0.02
R1639:Cyp2b23 UTSW 7 26686417 missense possibly damaging 0.77
R1741:Cyp2b23 UTSW 7 26673077 missense possibly damaging 0.94
R2042:Cyp2b23 UTSW 7 26666108 missense probably damaging 1.00
R3911:Cyp2b23 UTSW 7 26681417 missense probably benign 0.02
R4078:Cyp2b23 UTSW 7 26673092 missense probably damaging 1.00
R4279:Cyp2b23 UTSW 7 26666027 missense possibly damaging 0.89
R4668:Cyp2b23 UTSW 7 26672734 missense probably damaging 1.00
R5419:Cyp2b23 UTSW 7 26681423 nonsense probably null
R5516:Cyp2b23 UTSW 7 26673057 nonsense probably null
R5723:Cyp2b23 UTSW 7 26681396 missense probably benign 0.41
R5873:Cyp2b23 UTSW 7 26675006 missense probably benign 0.02
R6346:Cyp2b23 UTSW 7 26681725 missense probably damaging 0.98
R6977:Cyp2b23 UTSW 7 26681320 missense possibly damaging 0.87
R7131:Cyp2b23 UTSW 7 26681413 missense probably benign 0.25
R7181:Cyp2b23 UTSW 7 26674403 missense probably damaging 1.00
R7715:Cyp2b23 UTSW 7 26681695 missense probably benign
R7877:Cyp2b23 UTSW 7 26686426 missense probably damaging 0.97
R8004:Cyp2b23 UTSW 7 26679466 missense probably benign
R8072:Cyp2b23 UTSW 7 26666006 missense probably damaging 1.00
R8083:Cyp2b23 UTSW 7 26686403 missense possibly damaging 0.62
Z1088:Cyp2b23 UTSW 7 26681411 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCACAAACAGGGTAAGATTTGTG -3'
(R):5'- AGGGCACTGTGTTCTCTCAG -3'

Sequencing Primer
(F):5'- CAAACAGGGTAAGATTTGTGATTAGG -3'
(R):5'- AGAGTATCCTTGCTCTGAACTG -3'
Posted On2019-12-20