Mutagenetix > Incidental Mutation

Incidental Mutation 'R0148:Bod1l'

60870

Institutional Source

Beutler Lab

Gene Symbol

Bod1l

Ensembl Gene

ENSMUSG00000061755

Gene Name

biorientation of chromosomes in cell division 1-like

Synonyms

A230054D04Rik

MMRRC Submission

038432-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R0148 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41787538-41844315 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 41818697 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 1758 (A1758E)

Ref Sequence

ENSEMBL: ENSMUSP00000144359 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000050556
AA Change: A1758E

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: A1758E

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	1.8e-28	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	3.21e-1	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201291

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202200

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202908
AA Change: A1758E

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: A1758E

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	2.9e-24	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	1.9e-3	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 96.0%
20x: 91.8%

Validation Efficiency

86% (30/35)

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,662,446		probably null	Het
Agtr1a	T	C	13: 30,381,944	S331P	probably benign	Het
Ank1	T	A	8: 23,123,977	N1545K	probably damaging	Het
Bahcc1	A	T	11: 120,268,404	Q152H	probably damaging	Het
Bend3	T	A	10: 43,511,950	Y780N	probably damaging	Het
Ctcfl	T	C	2: 173,118,547	D81G	possibly damaging	Het
Ddx39	C	T	8: 83,722,476	R298C	possibly damaging	Het
Dock8	T	C	19: 25,119,459	L577P	probably benign	Het
Drc1	A	T	5: 30,281,489	N13I	possibly damaging	Het
Efl1	T	C	7: 82,671,670	S104P	probably damaging	Het
Eml4	T	A	17: 83,421,652	N85K	probably damaging	Het
Epb41l4a	T	C	18: 33,798,800	T581A	probably damaging	Het
Epha3	T	C	16: 63,612,944	D446G	possibly damaging	Het
Fam209	G	T	2: 172,473,980	G92C	probably damaging	Het
Fbln1	G	A	15: 85,230,826	R193H	probably damaging	Het
Fbxw21	A	G	9: 109,148,017		probably null	Het
Fgf17	C	T	14: 70,638,873	R49Q	probably damaging	Het
Flnb	T	C	14: 7,939,077	S2307P	probably benign	Het
Galr1	A	G	18: 82,405,570	L194P	probably benign	Het
Gar1	T	C	3: 129,829,473	H89R	probably damaging	Het
Gbp4	T	A	5: 105,119,496	Y519F	probably benign	Het
Git1	A	G	11: 77,505,728	T601A	probably benign	Het
Gm10722	T	"C,A"	9: 3,001,405		probably null	Het
Gm5142	C	T	14: 59,178,670	R13H	possibly damaging	Het
Gria2	A	C	3: 80,707,731	W481G	probably damaging	Het
Homer2	T	C	7: 81,624,278	T57A	probably benign	Het
Hpse2	A	C	19: 42,931,660		probably null	Het
Hspb7	T	C	4: 141,423,991	I148T	probably damaging	Het
Htr1d	C	A	4: 136,443,477	T339K	probably damaging	Het
Il4ra	T	A	7: 125,575,537	C306S	probably damaging	Het
Kansl3	A	T	1: 36,353,816	C225S	probably damaging	Het
Lama3	G	A	18: 12,448,272	C596Y	probably damaging	Het
Lama5	T	C	2: 180,190,406	H1714R	probably benign	Het
March6	C	T	15: 31,490,612	V293M	probably damaging	Het
Med12l	A	G	3: 59,037,654	D100G	probably damaging	Het
Mettl14	G	A	3: 123,371,394	T316I	probably damaging	Het
Mmp15	A	T	8: 95,372,317	N591Y	probably benign	Het
Mrpl53	T	C	6: 83,109,537	L74P	probably damaging	Het
Mvp	C	T	7: 126,989,865	V577M	probably damaging	Het
Neb	T	C	2: 52,249,376	K140E	probably damaging	Het
Nfya	A	G	17: 48,398,998	V48A	possibly damaging	Het
Ngf	G	T	3: 102,509,803		probably benign	Het
Nipsnap3b	C	T	4: 53,017,088	A104V	possibly damaging	Het
Nlrp14	A	G	7: 107,182,721	Y375C	probably benign	Het
Nod1	A	G	6: 54,938,217	Y764H	probably damaging	Het
Olfr225	G	A	11: 59,613,494	V177M	probably damaging	Het
Olfr270	A	T	4: 52,971,232	I204F	probably benign	Het
Olfr873	T	G	9: 20,301,091	M297R	probably damaging	Het
Pcdhb19	A	T	18: 37,497,182	Q10L	probably benign	Het
Pdcl	T	C	2: 37,352,130	I203V	probably benign	Het
Peg10	C	A	6: 4,755,711	R96S	possibly damaging	Het
Pknox1	T	A	17: 31,604,790	N379K	probably benign	Het
Prodh	T	G	16: 18,077,813	Q360P	probably damaging	Het
Raf1	C	T	6: 115,632,973	G202S	probably benign	Het
Rgs11	T	A	17: 26,207,459		probably null	Het
Rilp	A	T	11: 75,510,233	H29L	probably damaging	Het
Rtel1	T	C	2: 181,321,046	C31R	probably damaging	Het
Rubcnl	T	A	14: 75,042,458	I427K	probably damaging	Het
Ryr1	C	A	7: 29,052,035	R3706L	probably damaging	Het
Ryr2	T	C	13: 11,714,548	D2396G	probably damaging	Het
Slc45a2	T	C	15: 11,025,868	S435P	probably damaging	Het
Spata17	A	G	1: 187,112,601	V111A	probably damaging	Het
Svep1	C	T	4: 58,116,608	D881N	possibly damaging	Het
Sypl2	T	A	3: 108,219,095	N67I	possibly damaging	Het
Tenm3	T	C	8: 48,236,720	Y1944C	probably damaging	Het
Tep1	A	T	14: 50,824,789	D2535E	possibly damaging	Het
Tkt	T	A	14: 30,572,220	I529N	probably damaging	Het
Trp53i11	T	G	2: 93,197,735	V39G	probably damaging	Het
Trpm2	C	T	10: 77,925,825	G997D	probably damaging	Het
Usp3	A	G	9: 66,540,167	V219A	possibly damaging	Het
Usp4	T	A	9: 108,391,671		probably null	Het
Wdfy3	A	G	5: 101,917,411	V1297A	probably benign	Het
Wdr46	T	A	17: 33,941,023	F70I	probably benign	Het
Xkr6	T	C	14: 63,819,549	V303A	unknown	Het
Zdbf2	C	T	1: 63,304,006	Q515*	probably null	Het
Zfhx2	A	G	14: 55,072,897	Y731H	possibly damaging	Het

Other mutations in Bod1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Bod1l	APN	5	41816823	missense	probably benign	0.00
IGL00990:Bod1l	APN	5	41828865	missense	probably benign	0.00
IGL01021:Bod1l	APN	5	41838173	splice site	probably benign
IGL01022:Bod1l	APN	5	41794309	missense	probably damaging	1.00
IGL01303:Bod1l	APN	5	41817599	missense	probably benign	0.00
IGL01654:Bod1l	APN	5	41818176	missense	probably damaging	0.99
IGL01748:Bod1l	APN	5	41816961	missense	probably benign	0.23
IGL01758:Bod1l	APN	5	41826610	splice site	probably benign
IGL01783:Bod1l	APN	5	41808712	missense	probably benign	0.02
IGL01790:Bod1l	APN	5	41832250	missense	probably benign	0.14
IGL01803:Bod1l	APN	5	41817389	missense	probably damaging	0.97
IGL01829:Bod1l	APN	5	41820468	missense	probably benign	0.25
IGL01952:Bod1l	APN	5	41816954	missense	possibly damaging	0.70
IGL02005:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02110:Bod1l	APN	5	41816453	missense	probably damaging	0.97
IGL02129:Bod1l	APN	5	41821850	missense	probably benign	0.36
IGL02572:Bod1l	APN	5	41821230	nonsense	probably null
IGL02583:Bod1l	APN	5	41816207	critical splice donor site	probably null
IGL02643:Bod1l	APN	5	41818805	missense	possibly damaging	0.65
IGL02714:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02728:Bod1l	APN	5	41826503	missense	probably damaging	1.00
IGL02752:Bod1l	APN	5	41816463	missense	possibly damaging	0.58
IGL02822:Bod1l	APN	5	41794345	missense	possibly damaging	0.94
IGL03032:Bod1l	APN	5	41831584	missense	probably benign	0.16
IGL03372:Bod1l	APN	5	41805235	splice site	probably benign
capacitance	UTSW	5	41791813	missense	possibly damaging	0.91
gauss	UTSW	5	41816867	missense	probably benign	0.01
Tesla	UTSW	5	41795068	critical splice donor site	probably null
R0102:Bod1l	UTSW	5	41817269	missense	probably benign	0.36
R0147:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0490:Bod1l	UTSW	5	41821892	missense	probably damaging	0.96
R0577:Bod1l	UTSW	5	41794887	missense	probably damaging	1.00
R0587:Bod1l	UTSW	5	41821637	missense	probably benign	0.16
R0620:Bod1l	UTSW	5	41801233	missense	probably benign	0.16
R0626:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R0785:Bod1l	UTSW	5	41820016	missense	probably benign	0.00
R1139:Bod1l	UTSW	5	41831471	missense	possibly damaging	0.64
R1165:Bod1l	UTSW	5	41821053	missense	probably benign	0.02
R1418:Bod1l	UTSW	5	41819471	missense	probably damaging	1.00
R1509:Bod1l	UTSW	5	41819540	missense	probably damaging	0.99
R1533:Bod1l	UTSW	5	41822155	nonsense	probably null
R1538:Bod1l	UTSW	5	41816429	missense	probably benign	0.00
R1591:Bod1l	UTSW	5	41819220	missense	probably benign	0.06
R1616:Bod1l	UTSW	5	41808715	missense	probably benign
R1628:Bod1l	UTSW	5	41816982	missense	probably benign	0.01
R1667:Bod1l	UTSW	5	41816775	missense	probably benign	0.01
R1869:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1870:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1993:Bod1l	UTSW	5	41817336	missense	probably damaging	1.00
R2060:Bod1l	UTSW	5	41808742	missense	possibly damaging	0.58
R2066:Bod1l	UTSW	5	41805156	missense	probably damaging	0.99
R2067:Bod1l	UTSW	5	41817086	missense	probably benign	0.11
R2073:Bod1l	UTSW	5	41819189	missense	probably benign	0.19
R2092:Bod1l	UTSW	5	41831517	missense	probably damaging	1.00
R2105:Bod1l	UTSW	5	41832279	missense	probably benign	0.00
R2243:Bod1l	UTSW	5	41821545	missense	possibly damaging	0.58
R2322:Bod1l	UTSW	5	41827120	missense	probably benign	0.09
R2849:Bod1l	UTSW	5	41838076	missense	probably damaging	1.00
R2883:Bod1l	UTSW	5	41832259	missense	probably benign	0.03
R3037:Bod1l	UTSW	5	41822037	missense	probably damaging	0.99
R3910:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3911:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3962:Bod1l	UTSW	5	41808721	missense	probably benign	0.07
R4235:Bod1l	UTSW	5	41821455	missense	probably damaging	1.00
R4308:Bod1l	UTSW	5	41791813	missense	possibly damaging	0.91
R4414:Bod1l	UTSW	5	41820527	missense	probably benign	0.04
R4535:Bod1l	UTSW	5	41832231	missense	probably benign	0.06
R4631:Bod1l	UTSW	5	41817735	missense	probably damaging	1.00
R4657:Bod1l	UTSW	5	41818612	missense	probably benign	0.00
R4782:Bod1l	UTSW	5	41833663	missense	probably benign	0.06
R4786:Bod1l	UTSW	5	41819438	missense	probably benign	0.43
R4840:Bod1l	UTSW	5	41818472	missense	probably damaging	1.00
R4877:Bod1l	UTSW	5	41819994	missense	probably benign	0.00
R4982:Bod1l	UTSW	5	41820473	missense	probably benign	0.00
R5152:Bod1l	UTSW	5	41816543	missense	probably benign	0.04
R5284:Bod1l	UTSW	5	41820467	missense	probably benign	0.05
R5354:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R5369:Bod1l	UTSW	5	41827183	missense	probably damaging	1.00
R5486:Bod1l	UTSW	5	41807181	missense	possibly damaging	0.56
R5541:Bod1l	UTSW	5	41791933	missense	probably benign	0.06
R5610:Bod1l	UTSW	5	41821874	missense	probably damaging	1.00
R5655:Bod1l	UTSW	5	41817044	missense	probably benign	0.06
R5705:Bod1l	UTSW	5	41817002	missense	probably benign	0.01
R5819:Bod1l	UTSW	5	41832605	missense	probably benign	0.27
R5890:Bod1l	UTSW	5	41820578	missense	probably benign	0.43
R5923:Bod1l	UTSW	5	41817419	missense	probably damaging	1.00
R5991:Bod1l	UTSW	5	41816863	nonsense	probably null
R6017:Bod1l	UTSW	5	41818760	missense	probably benign	0.01
R6253:Bod1l	UTSW	5	41826538	missense	probably damaging	0.96
R6284:Bod1l	UTSW	5	41818787	missense	probably benign	0.35
R6483:Bod1l	UTSW	5	41821082	missense	probably benign	0.03
R6485:Bod1l	UTSW	5	41817116	missense	possibly damaging	0.93
R6575:Bod1l	UTSW	5	41838068	missense	probably damaging	1.00
R6679:Bod1l	UTSW	5	41816666	missense	probably damaging	0.97
R6788:Bod1l	UTSW	5	41821873	nonsense	probably null
R7006:Bod1l	UTSW	5	41832552	missense	probably damaging	1.00
R7095:Bod1l	UTSW	5	41795068	critical splice donor site	probably null
R7111:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7190:Bod1l	UTSW	5	41819938	missense	probably benign	0.14
R7311:Bod1l	UTSW	5	41794333	missense	possibly damaging	0.57
R7336:Bod1l	UTSW	5	41821524	missense	probably damaging	1.00
R7341:Bod1l	UTSW	5	41788857	missense	probably benign	0.00
R7396:Bod1l	UTSW	5	41831546	missense	probably damaging	1.00
R7431:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7442:Bod1l	UTSW	5	41807179	missense	probably damaging	0.96
R7539:Bod1l	UTSW	5	41817860	missense	possibly damaging	0.65
R7583:Bod1l	UTSW	5	41833790	missense	probably damaging	1.00
R7679:Bod1l	UTSW	5	41820643	frame shift	probably null
R7748:Bod1l	UTSW	5	41832340	missense	probably damaging	0.97
R7767:Bod1l	UTSW	5	41816756	missense	probably benign	0.01
R7773:Bod1l	UTSW	5	41832712	missense	probably benign	0.14
R7782:Bod1l	UTSW	5	41817943	missense	probably benign	0.01
R7860:Bod1l	UTSW	5	41819265	missense	probably damaging	1.00
R7975:Bod1l	UTSW	5	41816277	missense	possibly damaging	0.90
R7977:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R7987:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R8104:Bod1l	UTSW	5	41833732	nonsense	probably null
R8217:Bod1l	UTSW	5	41831507	missense	probably damaging	1.00
R8307:Bod1l	UTSW	5	41821155	missense	probably damaging	1.00
R8469:Bod1l	UTSW	5	41821491	missense	possibly damaging	0.86
R8506:Bod1l	UTSW	5	41819055	nonsense	probably null
R8934:Bod1l	UTSW	5	41819601	missense	probably benign	0.11
R8984:Bod1l	UTSW	5	41788872	missense	probably damaging	1.00
R8989:Bod1l	UTSW	5	41821682	missense	probably benign	0.00
R8993:Bod1l	UTSW	5	41816867	missense	probably benign	0.01
R9128:Bod1l	UTSW	5	41788923	missense	probably benign	0.22
R9129:Bod1l	UTSW	5	41818877	missense	probably damaging	0.99
R9198:Bod1l	UTSW	5	41799786	missense	probably benign	0.08
R9254:Bod1l	UTSW	5	41821880	missense	probably damaging	1.00
R9445:Bod1l	UTSW	5	41817276	missense	probably benign	0.04
R9457:Bod1l	UTSW	5	41821967	missense	probably damaging	0.99
R9470:Bod1l	UTSW	5	41817096	missense	probably damaging	0.99
R9536:Bod1l	UTSW	5	41816962	missense	probably benign	0.01
R9654:Bod1l	UTSW	5	41818364	missense	probably benign	0.02
R9734:Bod1l	UTSW	5	41805230	missense	possibly damaging	0.91
R9771:Bod1l	UTSW	5	41791863	missense	probably damaging	0.96
X0027:Bod1l	UTSW	5	41832669	missense	probably benign	0.20
X0058:Bod1l	UTSW	5	41824018	missense	probably damaging	1.00
Z1088:Bod1l	UTSW	5	41808764	missense	possibly damaging	0.95
Z1088:Bod1l	UTSW	5	41821146	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAATGCCTTCATCATCACAGGGAC -3'
(R):5'- GGAGCTGTTACAAGTGCTGGAACG -3'

Sequencing Primer
(F):5'- CCACCAAAGGTGCATTAGTAATGTC -3'
(R):5'- GCAGGATCTCTGAGCAGTG -3'

Posted On

2013-07-24