Incidental Mutation 'R7880:Heg1'
ID608716
Institutional Source Beutler Lab
Gene Symbol Heg1
Ensembl Gene ENSMUSG00000075254
Gene Nameheart development protein with EGF-like domains 1
Synonyms5530401I02Rik, 9530025L16Rik, LOC268884, 4632417D23Rik
Accession Numbers

Genbank: NM_175256.5

Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R7880 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location33684370-33771576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33719509 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 280 (S280P)
Ref Sequence ENSEMBL: ENSMUSP00000119790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126532] [ENSMUST00000152782] [ENSMUST00000232568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000126532
AA Change: S280P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119790
Gene: ENSMUSG00000075254
AA Change: S280P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 471 480 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 556 575 N/A INTRINSIC
low complexity region 637 682 N/A INTRINSIC
low complexity region 868 888 N/A INTRINSIC
EGF 944 979 4e-5 SMART
EGF_CA 981 1019 1.01e-10 SMART
EGF_like 1139 1187 6.81e1 SMART
transmembrane domain 1204 1226 N/A INTRINSIC
PDB:4HDQ|C 1312 1337 2e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152782
SMART Domains Protein: ENSMUSP00000123686
Gene: ENSMUSG00000075254

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 104 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 185 202 N/A INTRINSIC
low complexity region 301 320 N/A INTRINSIC
low complexity region 382 427 N/A INTRINSIC
low complexity region 613 633 N/A INTRINSIC
EGF 689 724 4e-5 SMART
EGF_CA 726 764 1.01e-10 SMART
EGF_like 884 932 6.81e1 SMART
transmembrane domain 949 971 N/A INTRINSIC
PDB:4HDQ|C 1057 1082 1e-10 PDB
Predicted Effect unknown
Transcript: ENSMUST00000232568
AA Change: S183P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired integrity of the heart, blood vessels and lymphatic vessels, resulting in hemopericardium, lung hemorrhage, lymphangiectasis, and chylous ascites, as well as embryonic and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Gene trapped(3)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,909,962 D703V possibly damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Akap13 A G 7: 75,586,216 T180A probably damaging Het
Arhgap31 G A 16: 38,602,725 A993V probably benign Het
Asxl3 C T 18: 22,522,151 P1073S possibly damaging Het
Bmp3 T G 5: 98,872,575 S286A probably damaging Het
Cacna2d4 C T 6: 119,349,155 S1078F probably damaging Het
Cd101 A G 3: 101,007,866 L799P probably benign Het
Chst13 C T 6: 90,325,080 R28H possibly damaging Het
CN725425 T A 15: 91,246,105 C390* probably null Het
Crabp1 C A 9: 54,765,658 C82* probably null Het
Cyp2b23 A C 7: 26,673,134 V352G probably damaging Het
Dmrta1 T A 4: 89,688,844 V179E possibly damaging Het
Ect2l T C 10: 18,136,954 D839G possibly damaging Het
Espnl A T 1: 91,344,766 E616V possibly damaging Het
Fam50b C A 13: 34,746,819 Q93K probably benign Het
Focad C T 4: 88,401,170 R1539C unknown Het
Gm14443 T A 2: 175,169,370 I428L probably benign Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm7030 T A 17: 36,127,869 H210L possibly damaging Het
Gramd1c C G 16: 43,992,076 A193P probably benign Het
Gsn A G 2: 35,283,927 H54R probably damaging Het
Gucy2g T A 19: 55,206,280 I902F probably damaging Het
Herc1 G T 9: 66,508,224 R4827L probably damaging Het
Igsf21 A G 4: 140,157,508 C46R probably damaging Het
Kansl1 G T 11: 104,424,153 A353D probably damaging Het
Kcnab3 A G 11: 69,331,464 Y311C probably damaging Het
Kctd18 A G 1: 57,967,619 I24T possibly damaging Het
Lpcat4 C A 2: 112,240,031 H30N probably benign Het
Lrrc4c A G 2: 97,630,798 I590V probably benign Het
Lrrc69 T C 4: 14,703,946 I291M possibly damaging Het
Nsun6 A C 2: 14,996,379 C455W probably damaging Het
Olfr1112 T A 2: 87,192,090 C134* probably null Het
Olfr1264 A T 2: 90,022,037 F10I probably damaging Het
Olfr832 T G 9: 18,944,728 L27V probably benign Het
Olfr992 G T 2: 85,400,035 S166Y possibly damaging Het
Orc6 T C 8: 85,305,244 I162T probably benign Het
Pex13 A T 11: 23,649,369 S381T probably benign Het
Ppil1 G A 17: 29,261,788 H54Y probably damaging Het
Prrt4 T C 6: 29,170,156 I766V probably benign Het
Rab32 C T 10: 10,546,415 V187M probably damaging Het
Sema5a T A 15: 32,686,808 I1022N probably damaging Het
Sipa1l2 T C 8: 125,464,393 T953A probably damaging Het
Snapc3 T C 4: 83,435,194 S157P probably damaging Het
Spink5 A G 18: 43,986,326 R235G probably benign Het
Stx5a G A 19: 8,742,328 G19D probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Taf4 G A 2: 179,935,933 R532* probably null Het
Tmpo T A 10: 91,166,030 K106* probably null Het
Trnt1 T C 6: 106,769,556 probably null Het
Vmn1r228 A T 17: 20,776,410 I282N probably damaging Het
Vps13d A T 4: 145,181,114 probably null Het
Zfp703 A G 8: 26,978,690 I51V unknown Het
Zfp787 A G 7: 6,132,191 F354L probably benign Het
Znrf2 T C 6: 54,817,347 V111A probably benign Het
Zwint G T 10: 72,657,092 R182L probably benign Het
Other mutations in Heg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Heg1 APN 16 33710607 missense probably damaging 0.98
IGL01133:Heg1 APN 16 33727287 missense probably benign 0.01
IGL01410:Heg1 APN 16 33725566 missense possibly damaging 0.95
IGL01561:Heg1 APN 16 33766668 missense probably benign 0.27
IGL02449:Heg1 APN 16 33738725 critical splice donor site probably null
IGL02523:Heg1 APN 16 33738622 missense probably damaging 1.00
IGL02794:Heg1 APN 16 33726622 missense probably damaging 0.99
IGL03240:Heg1 APN 16 33727413 missense probably benign 0.02
I2289:Heg1 UTSW 16 33763459 missense probably damaging 1.00
R0089:Heg1 UTSW 16 33763615 missense probably damaging 1.00
R0116:Heg1 UTSW 16 33735658 splice site probably benign
R0514:Heg1 UTSW 16 33726756 missense possibly damaging 0.86
R0589:Heg1 UTSW 16 33731707 missense probably damaging 1.00
R0942:Heg1 UTSW 16 33760803 missense probably damaging 1.00
R1084:Heg1 UTSW 16 33706997 missense probably benign 0.26
R1109:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R1375:Heg1 UTSW 16 33726876 missense possibly damaging 0.75
R1375:Heg1 UTSW 16 33727309 missense possibly damaging 0.60
R1550:Heg1 UTSW 16 33735553 missense probably damaging 1.00
R1720:Heg1 UTSW 16 33707179 missense probably benign 0.44
R1739:Heg1 UTSW 16 33738583 missense possibly damaging 0.94
R2068:Heg1 UTSW 16 33727590 missense probably benign 0.14
R2397:Heg1 UTSW 16 33742479 missense probably damaging 0.99
R4353:Heg1 UTSW 16 33710477 missense probably benign 0.41
R4419:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4420:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4779:Heg1 UTSW 16 33719772 missense probably benign 0.41
R5066:Heg1 UTSW 16 33738671 missense probably benign 0.41
R5227:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R5494:Heg1 UTSW 16 33725434 missense probably benign 0.44
R5645:Heg1 UTSW 16 33706963 missense probably benign
R5708:Heg1 UTSW 16 33742404 missense probably damaging 0.99
R5934:Heg1 UTSW 16 33726919 missense probably damaging 1.00
R6074:Heg1 UTSW 16 33727203 missense possibly damaging 0.49
R6374:Heg1 UTSW 16 33727129 missense possibly damaging 0.86
R6398:Heg1 UTSW 16 33766775 missense probably damaging 0.99
R6774:Heg1 UTSW 16 33738268 missense probably damaging 1.00
R6843:Heg1 UTSW 16 33719526 missense probably benign 0.41
R7091:Heg1 UTSW 16 33726720 missense probably benign 0.01
R7183:Heg1 UTSW 16 33738550 splice site probably null
R7186:Heg1 UTSW 16 33731664 missense probably damaging 1.00
R7294:Heg1 UTSW 16 33726489 missense probably damaging 0.99
R7304:Heg1 UTSW 16 33760790 missense possibly damaging 0.52
R7405:Heg1 UTSW 16 33763449 missense possibly damaging 0.66
R7614:Heg1 UTSW 16 33727363 missense probably benign
R7638:Heg1 UTSW 16 33727497 missense probably damaging 1.00
R7942:Heg1 UTSW 16 33751200 missense probably damaging 1.00
R7977:Heg1 UTSW 16 33720730 nonsense probably null
R7984:Heg1 UTSW 16 33763575 missense possibly damaging 0.83
R7987:Heg1 UTSW 16 33720730 nonsense probably null
R8023:Heg1 UTSW 16 33730525 missense possibly damaging 0.61
R8312:Heg1 UTSW 16 33726675 missense probably benign 0.02
X0066:Heg1 UTSW 16 33727416 missense probably benign 0.16
Z1177:Heg1 UTSW 16 33720687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCTAGTTGTGCCTGCATG -3'
(R):5'- TCCTTGAGTCCTTCACAGAGG -3'

Sequencing Primer
(F):5'- GTGCCTGCATGTATCAACACG -3'
(R):5'- TATACCAAGTCTGGAGTGCTCAG -3'
Posted On2019-12-20