Incidental Mutation 'R7880:Vmn1r228'
ID 608720
Institutional Source Beutler Lab
Gene Symbol Vmn1r228
Ensembl Gene ENSMUSG00000060245
Gene Name vomeronasal 1 receptor 228
Synonyms V1re3
MMRRC Submission 045932-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R7880 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20996321-20997763 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20996672 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 282 (I282N)
Ref Sequence ENSEMBL: ENSMUSP00000072243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072410]
AlphaFold Q8R2A7
Predicted Effect probably damaging
Transcript: ENSMUST00000072410
AA Change: I282N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072243
Gene: ENSMUSG00000060245
AA Change: I282N

DomainStartEndE-ValueType
Pfam:TAS2R 32 317 2.6e-11 PFAM
Pfam:7tm_1 53 316 2.6e-9 PFAM
Pfam:V1R 63 321 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,511,691 (GRCm39) D703V possibly damaging Het
Adamts1 G A 16: 85,594,940 (GRCm39) R340* probably null Het
Akap13 A G 7: 75,235,964 (GRCm39) T180A probably damaging Het
Arhgap31 G A 16: 38,423,087 (GRCm39) A993V probably benign Het
Asxl3 C T 18: 22,655,208 (GRCm39) P1073S possibly damaging Het
Bmp3 T G 5: 99,020,434 (GRCm39) S286A probably damaging Het
Cacna2d4 C T 6: 119,326,116 (GRCm39) S1078F probably damaging Het
Cd101 A G 3: 100,915,182 (GRCm39) L799P probably benign Het
Chst13 C T 6: 90,302,062 (GRCm39) R28H possibly damaging Het
CN725425 T A 15: 91,130,308 (GRCm39) C390* probably null Het
Crabp1 C A 9: 54,672,942 (GRCm39) C82* probably null Het
Cyp2b23 A C 7: 26,372,559 (GRCm39) V352G probably damaging Het
Dmrta1 T A 4: 89,577,081 (GRCm39) V179E possibly damaging Het
Ect2l T C 10: 18,012,702 (GRCm39) D839G possibly damaging Het
Espnl A T 1: 91,272,488 (GRCm39) E616V possibly damaging Het
Fam50b C A 13: 34,930,802 (GRCm39) Q93K probably benign Het
Focad C T 4: 88,319,407 (GRCm39) R1539C unknown Het
Gm14443 T A 2: 175,011,163 (GRCm39) I428L probably benign Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,133,040 (GRCm39) probably benign Het
Gramd1c C G 16: 43,812,439 (GRCm39) A193P probably benign Het
Gsn A G 2: 35,173,939 (GRCm39) H54R probably damaging Het
Gucy2g T A 19: 55,194,712 (GRCm39) I902F probably damaging Het
H2-T9 T A 17: 36,438,761 (GRCm39) H210L possibly damaging Het
Heg1 T C 16: 33,539,879 (GRCm39) S280P possibly damaging Het
Herc1 G T 9: 66,415,506 (GRCm39) R4827L probably damaging Het
Igsf21 A G 4: 139,884,819 (GRCm39) C46R probably damaging Het
Kansl1 G T 11: 104,314,979 (GRCm39) A353D probably damaging Het
Kcnab3 A G 11: 69,222,290 (GRCm39) Y311C probably damaging Het
Kctd18 A G 1: 58,006,778 (GRCm39) I24T possibly damaging Het
Lpcat4 C A 2: 112,070,376 (GRCm39) H30N probably benign Het
Lrrc4c A G 2: 97,461,143 (GRCm39) I590V probably benign Het
Lrrc69 T C 4: 14,703,946 (GRCm39) I291M possibly damaging Het
Nsun6 A C 2: 15,001,190 (GRCm39) C455W probably damaging Het
Or12e1 T A 2: 87,022,434 (GRCm39) C134* probably null Het
Or4c3 A T 2: 89,852,381 (GRCm39) F10I probably damaging Het
Or5ak22 G T 2: 85,230,379 (GRCm39) S166Y possibly damaging Het
Or7g19 T G 9: 18,856,024 (GRCm39) L27V probably benign Het
Orc6 T C 8: 86,031,873 (GRCm39) I162T probably benign Het
Pex13 A T 11: 23,599,369 (GRCm39) S381T probably benign Het
Ppil1 G A 17: 29,480,762 (GRCm39) H54Y probably damaging Het
Prrt4 T C 6: 29,170,155 (GRCm39) I766V probably benign Het
Rab32 C T 10: 10,422,159 (GRCm39) V187M probably damaging Het
Sema5a T A 15: 32,686,954 (GRCm39) I1022N probably damaging Het
Sipa1l2 T C 8: 126,191,132 (GRCm39) T953A probably damaging Het
Snapc3 T C 4: 83,353,431 (GRCm39) S157P probably damaging Het
Spink5 A G 18: 44,119,393 (GRCm39) R235G probably benign Het
Stx5a G A 19: 8,719,692 (GRCm39) G19D probably damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Taf4 G A 2: 179,577,726 (GRCm39) R532* probably null Het
Tmpo T A 10: 91,001,892 (GRCm39) K106* probably null Het
Trnt1 T C 6: 106,746,517 (GRCm39) probably null Het
Vps13d A T 4: 144,907,684 (GRCm39) probably null Het
Zfp703 A G 8: 27,468,718 (GRCm39) I51V unknown Het
Zfp787 A G 7: 6,135,190 (GRCm39) F354L probably benign Het
Znrf2 T C 6: 54,794,332 (GRCm39) V111A probably benign Het
Zwint G T 10: 72,492,924 (GRCm39) R182L probably benign Het
Other mutations in Vmn1r228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Vmn1r228 APN 17 20,996,774 (GRCm39) missense probably benign 0.07
IGL03275:Vmn1r228 APN 17 20,997,104 (GRCm39) missense probably damaging 1.00
PIT4498001:Vmn1r228 UTSW 17 20,996,772 (GRCm39) missense probably benign 0.00
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0270:Vmn1r228 UTSW 17 20,996,858 (GRCm39) missense possibly damaging 0.60
R0279:Vmn1r228 UTSW 17 20,996,637 (GRCm39) missense probably benign 0.02
R1544:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R1695:Vmn1r228 UTSW 17 20,996,560 (GRCm39) missense possibly damaging 0.49
R2086:Vmn1r228 UTSW 17 20,997,455 (GRCm39) missense possibly damaging 0.71
R2275:Vmn1r228 UTSW 17 20,996,807 (GRCm39) missense probably damaging 1.00
R2965:Vmn1r228 UTSW 17 20,996,609 (GRCm39) missense probably damaging 0.99
R4425:Vmn1r228 UTSW 17 20,996,861 (GRCm39) missense probably damaging 1.00
R4447:Vmn1r228 UTSW 17 20,997,369 (GRCm39) missense probably damaging 0.96
R5031:Vmn1r228 UTSW 17 20,996,943 (GRCm39) nonsense probably null
R6345:Vmn1r228 UTSW 17 20,997,144 (GRCm39) missense probably damaging 1.00
R7064:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R8000:Vmn1r228 UTSW 17 20,997,227 (GRCm39) missense possibly damaging 0.88
R8290:Vmn1r228 UTSW 17 20,996,724 (GRCm39) missense probably benign 0.09
R9022:Vmn1r228 UTSW 17 20,996,778 (GRCm39) missense probably damaging 1.00
R9027:Vmn1r228 UTSW 17 20,997,422 (GRCm39) missense probably benign 0.01
R9291:Vmn1r228 UTSW 17 20,997,023 (GRCm39) missense probably benign
R9492:Vmn1r228 UTSW 17 20,996,862 (GRCm39) missense probably damaging 1.00
R9618:Vmn1r228 UTSW 17 20,997,045 (GRCm39) missense probably benign 0.00
X0018:Vmn1r228 UTSW 17 20,996,963 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TATCCTCACGGTAGGAAGAGAG -3'
(R):5'- ACTCATTGTAGTTTCCAGCACC -3'

Sequencing Primer
(F):5'- ACCTGTGGTTATCCAGACTATAAGGG -3'
(R):5'- GTAGTTTCCAGCACCTTCATGATTG -3'
Posted On 2019-12-20