Incidental Mutation 'R7881:Kmt2b'
Institutional Source Beutler Lab
Gene Symbol Kmt2b
Ensembl Gene ENSMUSG00000006307
Gene Namelysine (K)-specific methyltransferase 2B
Synonyms2610014H22Rik, Wbp7, Mll2
MMRRC Submission
Accession Numbers

Genbank: NM_029274; MGI: 109565

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7881 (G1)
Quality Score225.009
Status Validated
Chromosomal Location30568858-30588726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30579783 bp
Amino Acid Change Serine to Proline at position 1485 (S1485P)
Ref Sequence ENSEMBL: ENSMUSP00000103789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108154]
Predicted Effect probably damaging
Transcript: ENSMUST00000006470
AA Change: S1485P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307
AA Change: S1485P

AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108154
AA Change: S1485P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307
AA Change: S1485P

AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307
AA Change: S776P

low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]
Allele List at MGI

 All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,323,566 N1030S possibly damaging Het
4930507D05Rik A G 10: 62,449,524 H9R unknown Het
Anks1b T A 10: 90,967,018 S398T probably benign Het
Bbox1 T A 2: 110,292,526 K139N probably benign Het
Birc6 C A 17: 74,641,671 H3047N probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camta1 G A 4: 151,835,876 S18F probably damaging Het
Ccnb1ip1 T C 14: 50,793,820 Y12C possibly damaging Het
Celsr3 G A 9: 108,828,072 A585T probably benign Het
Col6a4 T C 9: 106,080,298 N109S probably benign Het
Crisp4 A T 1: 18,128,669 D180E probably benign Het
D230025D16Rik C A 8: 105,249,452 T347N probably benign Het
Dmxl1 T A 18: 49,864,383 M546K probably damaging Het
Dnah11 C T 12: 117,987,502 V3024I probably benign Het
Dnah2 T C 11: 69,431,238 D3752G probably damaging Het
Dram1 G T 10: 88,324,747 D237E probably benign Het
Ehbp1l1 T C 19: 5,719,398 N626D probably benign Het
Elavl1 T G 8: 4,311,763 N3T probably damaging Het
Fam184a A G 10: 53,698,493 V340A probably benign Het
Fam205a1 C T 4: 42,851,586 C190Y probably benign Het
Fam35a A T 14: 34,267,767 M394K possibly damaging Het
Fer1l5 C T 1: 36,407,036 T876M not run Het
Foxp2 T A 6: 15,409,889 V471E unknown Het
Fstl5 G A 3: 76,536,298 G317R probably damaging Het
Gm30302 A G 13: 49,790,071 S44P possibly damaging Het
Gm32742 T C 9: 51,149,114 E963G possibly damaging Het
Gpbp1 A T 13: 111,439,199 S257T possibly damaging Het
Gsdmc4 C T 15: 63,897,719 C218Y possibly damaging Het
Hmg20b T C 10: 81,346,608 H298R probably damaging Het
Igf2r A T 17: 12,748,704 C72S probably benign Het
Kcnip1 A G 11: 33,633,206 M193T probably damaging Het
Khdc1c G T 1: 21,369,675 C150F probably benign Het
Lnpep A G 17: 17,566,739 S533P probably benign Het
Megf8 T A 7: 25,340,635 V997E possibly damaging Het
Mob2 T C 7: 142,009,440 Y94C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Npepl1 A G 2: 174,120,594 D351G probably damaging Het
Nrg1 G A 8: 31,838,324 Q213* probably null Het
Nrp2 A G 1: 62,771,831 D677G probably benign Het
Olfr1033 C A 2: 86,041,470 Q52K probably benign Het
Olfr124 G T 17: 37,805,429 G95C probably damaging Het
Olfr143 T A 9: 38,254,110 M228K probably benign Het
Olfr259 G T 2: 87,108,057 T110K probably damaging Het
Olfr679 G T 7: 105,086,573 V286F probably damaging Het
Olfr746 A G 14: 50,653,447 E70G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Prune2 G A 19: 17,123,029 V1966I possibly damaging Het
Ptch2 A G 4: 117,110,388 H751R probably benign Het
Ptges2 T A 2: 32,402,231 M353K probably damaging Het
Pum3 G A 19: 27,396,328 Q564* probably null Het
Qtrt1 A G 9: 21,419,341 D279G probably damaging Het
Rftn1 C T 17: 50,047,435 V300I probably benign Het
Robo2 T C 16: 73,920,697 T1172A probably benign Het
Sdc3 A G 4: 130,816,933 D74G unknown Het
Setd1b A G 5: 123,152,273 M768V unknown Het
Siglech A T 7: 55,772,541 H298L probably benign Het
Sipa1 A T 19: 5,651,676 L977Q probably damaging Het
Slc9c1 G A 16: 45,582,969 V800I probably benign Het
Tbc1d8 C T 1: 39,386,023 R582Q probably damaging Het
Tmem247 T A 17: 86,922,300 F190I probably damaging Het
Trim42 C A 9: 97,363,017 A577S possibly damaging Het
Ubiad1 G A 4: 148,444,269 T61I probably benign Het
Usp40 G A 1: 87,995,713 Q279* probably null Het
Usp48 A G 4: 137,633,455 N733S probably benign Het
Vmn2r83 A T 10: 79,478,427 I170F probably benign Het
Xkr4 G A 1: 3,216,264 P568S probably damaging Het
Zc3h7b T C 15: 81,780,478 W513R probably damaging Het
Zfp40 T C 17: 23,191,466 probably benign Het
Zfp652 T A 11: 95,750,109 S287T possibly damaging Het
Znrf3 G A 11: 5,444,533 A49V unknown Het
Other mutations in Kmt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Kmt2b APN 7 30586513 unclassified probably benign
IGL00821:Kmt2b APN 7 30570613 missense probably damaging 1.00
IGL00985:Kmt2b APN 7 30579927 missense probably damaging 1.00
IGL01092:Kmt2b APN 7 30580507 missense probably damaging 1.00
IGL01933:Kmt2b APN 7 30569514 critical splice donor site probably null
IGL01949:Kmt2b APN 7 30577161 splice site probably null
IGL02253:Kmt2b APN 7 30581727 missense probably damaging 1.00
IGL02455:Kmt2b APN 7 30578878 critical splice donor site probably null
IGL02493:Kmt2b APN 7 30569511 unclassified probably benign
IGL02504:Kmt2b APN 7 30586543 unclassified probably benign
IGL02532:Kmt2b APN 7 30586889 unclassified probably benign
IGL02698:Kmt2b APN 7 30578693 splice site probably benign
IGL02717:Kmt2b APN 7 30583444 missense probably damaging 1.00
IGL02826:Kmt2b APN 7 30577144 missense probably damaging 1.00
IGL02966:Kmt2b APN 7 30575462 missense probably benign 0.02
IGL03386:Kmt2b APN 7 30573971 missense possibly damaging 0.94
ivoire UTSW 7 30584559 missense probably damaging 0.98
3-1:Kmt2b UTSW 7 30569615 nonsense probably null
FR4304:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4342:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4548:Kmt2b UTSW 7 30586380 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586364 nonsense probably null
FR4589:Kmt2b UTSW 7 30586381 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586367 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586370 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586378 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586360 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586362 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586364 nonsense probably null
FR4976:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586373 unclassified probably benign
PIT4403001:Kmt2b UTSW 7 30585689 missense probably damaging 1.00
PIT4802001:Kmt2b UTSW 7 30579571 missense probably damaging 0.99
R0057:Kmt2b UTSW 7 30576792 splice site probably benign
R0131:Kmt2b UTSW 7 30583921 missense probably damaging 0.99
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0377:Kmt2b UTSW 7 30574193 missense probably damaging 1.00
R0396:Kmt2b UTSW 7 30576755 missense probably damaging 1.00
R1241:Kmt2b UTSW 7 30574940 missense probably damaging 0.98
R1252:Kmt2b UTSW 7 30580487 missense probably damaging 0.99
R1418:Kmt2b UTSW 7 30576960 splice site probably benign
R1599:Kmt2b UTSW 7 30570575 missense probably damaging 1.00
R1632:Kmt2b UTSW 7 30583962 missense probably damaging 1.00
R1745:Kmt2b UTSW 7 30585850 missense possibly damaging 0.90
R1867:Kmt2b UTSW 7 30574658 missense possibly damaging 0.71
R1955:Kmt2b UTSW 7 30575351 missense possibly damaging 0.90
R2040:Kmt2b UTSW 7 30569420 missense probably damaging 1.00
R2113:Kmt2b UTSW 7 30583387 missense probably damaging 1.00
R2216:Kmt2b UTSW 7 30574065 missense probably benign 0.25
R2401:Kmt2b UTSW 7 30576708 missense probably damaging 1.00
R2518:Kmt2b UTSW 7 30576068 missense probably benign 0.10
R3436:Kmt2b UTSW 7 30576692 missense probably damaging 1.00
R4248:Kmt2b UTSW 7 30574064 missense probably benign 0.25
R4259:Kmt2b UTSW 7 30581081 missense probably damaging 0.99
R4290:Kmt2b UTSW 7 30581836 critical splice donor site probably null
R4388:Kmt2b UTSW 7 30588590 unclassified probably benign
R4542:Kmt2b UTSW 7 30580259 missense probably damaging 0.99
R4649:Kmt2b UTSW 7 30586358 unclassified probably benign
R4722:Kmt2b UTSW 7 30583202 missense probably damaging 1.00
R4891:Kmt2b UTSW 7 30576761 nonsense probably null
R4916:Kmt2b UTSW 7 30578517 missense probably damaging 0.99
R5104:Kmt2b UTSW 7 30569840 missense probably damaging 1.00
R5254:Kmt2b UTSW 7 30569175 missense probably damaging 1.00
R5262:Kmt2b UTSW 7 30569794 missense probably damaging 1.00
R5307:Kmt2b UTSW 7 30581673 missense possibly damaging 0.91
R5526:Kmt2b UTSW 7 30580444 missense probably damaging 1.00
R5609:Kmt2b UTSW 7 30577145 missense probably damaging 0.99
R6150:Kmt2b UTSW 7 30588477 unclassified probably benign
R6727:Kmt2b UTSW 7 30584559 missense probably damaging 0.98
R6824:Kmt2b UTSW 7 30586276 unclassified probably benign
R7048:Kmt2b UTSW 7 30569306 missense probably damaging 0.99
R7155:Kmt2b UTSW 7 30579963 missense probably damaging 0.99
R7307:Kmt2b UTSW 7 30580471 missense probably damaging 0.99
R7388:Kmt2b UTSW 7 30581960 missense probably damaging 1.00
R7555:Kmt2b UTSW 7 30569410 missense possibly damaging 0.83
R7569:Kmt2b UTSW 7 30569553 missense possibly damaging 0.54
R7616:Kmt2b UTSW 7 30582208 missense probably damaging 1.00
R7669:Kmt2b UTSW 7 30583231 missense possibly damaging 0.84
R7999:Kmt2b UTSW 7 30576774 missense probably damaging 1.00
R8003:Kmt2b UTSW 7 30569377 missense probably damaging 0.98
R8189:Kmt2b UTSW 7 30569331 missense probably damaging 0.98
R8291:Kmt2b UTSW 7 30585469 missense probably damaging 1.00
R8314:Kmt2b UTSW 7 30578922 missense probably damaging 0.99
RF001:Kmt2b UTSW 7 30586382 unclassified probably benign
RF006:Kmt2b UTSW 7 30586377 unclassified probably benign
RF020:Kmt2b UTSW 7 30586382 unclassified probably benign
RF021:Kmt2b UTSW 7 30586357 unclassified probably benign
RF030:Kmt2b UTSW 7 30586377 unclassified probably benign
RF035:Kmt2b UTSW 7 30586357 unclassified probably benign
X0067:Kmt2b UTSW 7 30579573 missense probably damaging 0.99
Z1088:Kmt2b UTSW 7 30585251 missense probably benign 0.28
Z1176:Kmt2b UTSW 7 30577370 missense probably damaging 1.00
Z1177:Kmt2b UTSW 7 30575024 missense probably benign 0.08
Z1177:Kmt2b UTSW 7 30584163 missense probably damaging 0.98
Z1177:Kmt2b UTSW 7 30586416 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-20