Incidental Mutation 'R7881:Olfr679'
ID608754
Institutional Source Beutler Lab
Gene Symbol Olfr679
Ensembl Gene ENSMUSG00000096029
Gene Nameolfactory receptor 679
SynonymsMOR40-2, GA_x6K02T2PBJ9-7714499-7715446
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7881 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105081205-105090642 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105086573 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 286 (V286F)
Ref Sequence ENSEMBL: ENSMUSP00000150668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042676] [ENSMUST00000098158] [ENSMUST00000214328] [ENSMUST00000215704]
Predicted Effect probably benign
Transcript: ENSMUST00000042676
Predicted Effect probably damaging
Transcript: ENSMUST00000098158
AA Change: V286F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095761
Gene: ENSMUSG00000096029
AA Change: V286F

DomainStartEndE-ValueType
Pfam:7tm_4 35 314 1.2e-73 PFAM
Pfam:7TM_GPCR_Srsx 39 311 6.2e-10 PFAM
Pfam:7tm_1 45 296 1.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214328
AA Change: V286F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215704
AA Change: V286F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,323,566 N1030S possibly damaging Het
4930507D05Rik A G 10: 62,449,524 H9R unknown Het
Anks1b T A 10: 90,967,018 S398T probably benign Het
Bbox1 T A 2: 110,292,526 K139N probably benign Het
Birc6 C A 17: 74,641,671 H3047N probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camta1 G A 4: 151,835,876 S18F probably damaging Het
Ccnb1ip1 T C 14: 50,793,820 Y12C possibly damaging Het
Celsr3 G A 9: 108,828,072 A585T probably benign Het
Col6a4 T C 9: 106,080,298 N109S probably benign Het
Crisp4 A T 1: 18,128,669 D180E probably benign Het
D230025D16Rik C A 8: 105,249,452 T347N probably benign Het
Dmxl1 T A 18: 49,864,383 M546K probably damaging Het
Dnah11 C T 12: 117,987,502 V3024I probably benign Het
Dnah2 T C 11: 69,431,238 D3752G probably damaging Het
Dram1 G T 10: 88,324,747 D237E probably benign Het
Ehbp1l1 T C 19: 5,719,398 N626D probably benign Het
Elavl1 T G 8: 4,311,763 N3T probably damaging Het
Fam184a A G 10: 53,698,493 V340A probably benign Het
Fam205a1 C T 4: 42,851,586 C190Y probably benign Het
Fam35a A T 14: 34,267,767 M394K possibly damaging Het
Fer1l5 C T 1: 36,407,036 T876M not run Het
Foxp2 T A 6: 15,409,889 V471E unknown Het
Fstl5 G A 3: 76,536,298 G317R probably damaging Het
Gm30302 A G 13: 49,790,071 S44P possibly damaging Het
Gm32742 T C 9: 51,149,114 E963G possibly damaging Het
Gpbp1 A T 13: 111,439,199 S257T possibly damaging Het
Gsdmc4 C T 15: 63,897,719 C218Y possibly damaging Het
Hmg20b T C 10: 81,346,608 H298R probably damaging Het
Igf2r A T 17: 12,748,704 C72S probably benign Het
Kcnip1 A G 11: 33,633,206 M193T probably damaging Het
Khdc1c G T 1: 21,369,675 C150F probably benign Het
Kmt2b A G 7: 30,579,783 S1485P probably damaging Het
Lnpep A G 17: 17,566,739 S533P probably benign Het
Megf8 T A 7: 25,340,635 V997E possibly damaging Het
Mob2 T C 7: 142,009,440 Y94C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Npepl1 A G 2: 174,120,594 D351G probably damaging Het
Nrg1 G A 8: 31,838,324 Q213* probably null Het
Nrp2 A G 1: 62,771,831 D677G probably benign Het
Olfr1033 C A 2: 86,041,470 Q52K probably benign Het
Olfr124 G T 17: 37,805,429 G95C probably damaging Het
Olfr143 T A 9: 38,254,110 M228K probably benign Het
Olfr259 G T 2: 87,108,057 T110K probably damaging Het
Olfr746 A G 14: 50,653,447 E70G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Prune2 G A 19: 17,123,029 V1966I possibly damaging Het
Ptch2 A G 4: 117,110,388 H751R probably benign Het
Ptges2 T A 2: 32,402,231 M353K probably damaging Het
Pum3 G A 19: 27,396,328 Q564* probably null Het
Qtrt1 A G 9: 21,419,341 D279G probably damaging Het
Rftn1 C T 17: 50,047,435 V300I probably benign Het
Robo2 T C 16: 73,920,697 T1172A probably benign Het
Sdc3 A G 4: 130,816,933 D74G unknown Het
Setd1b A G 5: 123,152,273 M768V unknown Het
Siglech A T 7: 55,772,541 H298L probably benign Het
Sipa1 A T 19: 5,651,676 L977Q probably damaging Het
Slc9c1 G A 16: 45,582,969 V800I probably benign Het
Tbc1d8 C T 1: 39,386,023 R582Q probably damaging Het
Tmem247 T A 17: 86,922,300 F190I probably damaging Het
Trim42 C A 9: 97,363,017 A577S possibly damaging Het
Ubiad1 G A 4: 148,444,269 T61I probably benign Het
Usp40 G A 1: 87,995,713 Q279* probably null Het
Usp48 A G 4: 137,633,455 N733S probably benign Het
Vmn2r83 A T 10: 79,478,427 I170F probably benign Het
Xkr4 G A 1: 3,216,264 P568S probably damaging Het
Zc3h7b T C 15: 81,780,478 W513R probably damaging Het
Zfp40 T C 17: 23,191,466 probably benign Het
Zfp652 T A 11: 95,750,109 S287T possibly damaging Het
Znrf3 G A 11: 5,444,533 A49V unknown Het
Other mutations in Olfr679
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02247:Olfr679 APN 7 105086323 nonsense probably null
IGL02505:Olfr679 APN 7 105086333 missense probably benign
IGL03160:Olfr679 APN 7 105086313 missense probably damaging 1.00
R0079:Olfr679 UTSW 7 105085928 missense probably damaging 1.00
R2126:Olfr679 UTSW 7 105086615 missense probably damaging 1.00
R2185:Olfr679 UTSW 7 105086302 missense possibly damaging 0.79
R3122:Olfr679 UTSW 7 105086178 missense probably benign 0.00
R3828:Olfr679 UTSW 7 105086297 missense probably benign 0.00
R4235:Olfr679 UTSW 7 105085787 missense possibly damaging 0.71
R4360:Olfr679 UTSW 7 105086253 missense probably damaging 0.99
R4485:Olfr679 UTSW 7 105086601 missense probably damaging 1.00
R4790:Olfr679 UTSW 7 105086637 unclassified probably benign
R5542:Olfr679 UTSW 7 105086358 missense probably damaging 1.00
R5599:Olfr679 UTSW 7 105086550 splice site probably null
R5723:Olfr679 UTSW 7 105091102 missense probably damaging 0.99
R5770:Olfr679 UTSW 7 105090895 missense probably damaging 0.99
R5871:Olfr679 UTSW 7 105086304 missense possibly damaging 0.65
R7231:Olfr679 UTSW 7 105085787 missense possibly damaging 0.94
R7593:Olfr679 UTSW 7 105086165 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGAGACTCAAGGCAGAG -3'
(R):5'- GATGAAGCCAGGGATATTATTTTAGAG -3'

Sequencing Primer
(F):5'- GGGTGCTGTAGCCAAAGC -3'
(R):5'- CCACATTAGAATGTTCTGAGTTAGTG -3'
Posted On2019-12-20