Incidental Mutation 'R7881:Trim42'
ID608763
Institutional Source Beutler Lab
Gene Symbol Trim42
Ensembl Gene ENSMUSG00000032451
Gene Nametripartite motif-containing 42
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7881 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location97349562-97369958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 97363017 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 577 (A577S)
Ref Sequence ENSEMBL: ENSMUSP00000035026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035026]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035026
AA Change: A577S

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035026
Gene: ENSMUSG00000032451
AA Change: A577S

DomainStartEndE-ValueType
RING 146 191 3.67e-3 SMART
BBOX 233 280 1.42e0 SMART
BBOX 285 326 1.04e-2 SMART
low complexity region 386 399 N/A INTRINSIC
FN3 603 688 2.44e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, namely a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,323,566 N1030S possibly damaging Het
4930507D05Rik A G 10: 62,449,524 H9R unknown Het
Anks1b T A 10: 90,967,018 S398T probably benign Het
Bbox1 T A 2: 110,292,526 K139N probably benign Het
Birc6 C A 17: 74,641,671 H3047N probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camta1 G A 4: 151,835,876 S18F probably damaging Het
Ccnb1ip1 T C 14: 50,793,820 Y12C possibly damaging Het
Celsr3 G A 9: 108,828,072 A585T probably benign Het
Col6a4 T C 9: 106,080,298 N109S probably benign Het
Crisp4 A T 1: 18,128,669 D180E probably benign Het
D230025D16Rik C A 8: 105,249,452 T347N probably benign Het
Dmxl1 T A 18: 49,864,383 M546K probably damaging Het
Dnah11 C T 12: 117,987,502 V3024I probably benign Het
Dnah2 T C 11: 69,431,238 D3752G probably damaging Het
Dram1 G T 10: 88,324,747 D237E probably benign Het
Ehbp1l1 T C 19: 5,719,398 N626D probably benign Het
Elavl1 T G 8: 4,311,763 N3T probably damaging Het
Fam184a A G 10: 53,698,493 V340A probably benign Het
Fam205a1 C T 4: 42,851,586 C190Y probably benign Het
Fam35a A T 14: 34,267,767 M394K possibly damaging Het
Fer1l5 C T 1: 36,407,036 T876M not run Het
Foxp2 T A 6: 15,409,889 V471E unknown Het
Fstl5 G A 3: 76,536,298 G317R probably damaging Het
Gm30302 A G 13: 49,790,071 S44P possibly damaging Het
Gm32742 T C 9: 51,149,114 E963G possibly damaging Het
Gpbp1 A T 13: 111,439,199 S257T possibly damaging Het
Gsdmc4 C T 15: 63,897,719 C218Y possibly damaging Het
Hmg20b T C 10: 81,346,608 H298R probably damaging Het
Igf2r A T 17: 12,748,704 C72S probably benign Het
Kcnip1 A G 11: 33,633,206 M193T probably damaging Het
Khdc1c G T 1: 21,369,675 C150F probably benign Het
Kmt2b A G 7: 30,579,783 S1485P probably damaging Het
Lnpep A G 17: 17,566,739 S533P probably benign Het
Megf8 T A 7: 25,340,635 V997E possibly damaging Het
Mob2 T C 7: 142,009,440 Y94C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Npepl1 A G 2: 174,120,594 D351G probably damaging Het
Nrg1 G A 8: 31,838,324 Q213* probably null Het
Nrp2 A G 1: 62,771,831 D677G probably benign Het
Olfr1033 C A 2: 86,041,470 Q52K probably benign Het
Olfr124 G T 17: 37,805,429 G95C probably damaging Het
Olfr143 T A 9: 38,254,110 M228K probably benign Het
Olfr259 G T 2: 87,108,057 T110K probably damaging Het
Olfr679 G T 7: 105,086,573 V286F probably damaging Het
Olfr746 A G 14: 50,653,447 E70G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Prune2 G A 19: 17,123,029 V1966I possibly damaging Het
Ptch2 A G 4: 117,110,388 H751R probably benign Het
Ptges2 T A 2: 32,402,231 M353K probably damaging Het
Pum3 G A 19: 27,396,328 Q564* probably null Het
Qtrt1 A G 9: 21,419,341 D279G probably damaging Het
Rftn1 C T 17: 50,047,435 V300I probably benign Het
Robo2 T C 16: 73,920,697 T1172A probably benign Het
Sdc3 A G 4: 130,816,933 D74G unknown Het
Setd1b A G 5: 123,152,273 M768V unknown Het
Siglech A T 7: 55,772,541 H298L probably benign Het
Sipa1 A T 19: 5,651,676 L977Q probably damaging Het
Slc9c1 G A 16: 45,582,969 V800I probably benign Het
Tbc1d8 C T 1: 39,386,023 R582Q probably damaging Het
Tmem247 T A 17: 86,922,300 F190I probably damaging Het
Ubiad1 G A 4: 148,444,269 T61I probably benign Het
Usp40 G A 1: 87,995,713 Q279* probably null Het
Usp48 A G 4: 137,633,455 N733S probably benign Het
Vmn2r83 A T 10: 79,478,427 I170F probably benign Het
Xkr4 G A 1: 3,216,264 P568S probably damaging Het
Zc3h7b T C 15: 81,780,478 W513R probably damaging Het
Zfp40 T C 17: 23,191,466 probably benign Het
Zfp652 T A 11: 95,750,109 S287T possibly damaging Het
Znrf3 G A 11: 5,444,533 A49V unknown Het
Other mutations in Trim42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02289:Trim42 APN 9 97359233 missense probably damaging 0.97
IGL02987:Trim42 APN 9 97365815 missense probably benign 0.28
R0116:Trim42 UTSW 9 97363403 missense possibly damaging 0.89
R0791:Trim42 UTSW 9 97365679 missense probably damaging 1.00
R1170:Trim42 UTSW 9 97363620 missense probably benign 0.04
R1397:Trim42 UTSW 9 97365621 missense probably damaging 1.00
R1499:Trim42 UTSW 9 97366085 missense possibly damaging 0.95
R1522:Trim42 UTSW 9 97365679 missense probably damaging 1.00
R2094:Trim42 UTSW 9 97366097 missense probably benign 0.23
R2355:Trim42 UTSW 9 97359240 missense probably damaging 1.00
R4621:Trim42 UTSW 9 97363148 missense probably benign
R4649:Trim42 UTSW 9 97362945 missense probably benign 0.00
R4840:Trim42 UTSW 9 97362929 missense probably benign 0.02
R6147:Trim42 UTSW 9 97363329 missense probably benign
R7048:Trim42 UTSW 9 97363421 missense probably damaging 1.00
R7235:Trim42 UTSW 9 97369708 missense probably damaging 0.99
R7276:Trim42 UTSW 9 97369572 nonsense probably null
R7390:Trim42 UTSW 9 97359129 missense probably damaging 1.00
R7442:Trim42 UTSW 9 97362945 missense probably damaging 0.97
R7650:Trim42 UTSW 9 97363148 missense probably benign
R8060:Trim42 UTSW 9 97363479 missense probably damaging 1.00
Z1088:Trim42 UTSW 9 97369622 missense probably benign 0.00
Z1177:Trim42 UTSW 9 97362906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACCACATTCTAGAGGCC -3'
(R):5'- GGTGACATTCAGCACCCATAGC -3'

Sequencing Primer
(F):5'- AGCAGTATAGGCAACCTTCTCTG -3'
(R):5'- ATTCAGCACCCATAGCTTCGG -3'
Posted On2019-12-20