Incidental Mutation 'R7881:2210408I21Rik'
ID608778
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene NameRIKEN cDNA 2210408I21 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7881 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location77135540-77613784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77323566 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1030 (N1030S)
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168779
AA Change: N1030S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: N1030S

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930507D05Rik A G 10: 62,449,524 H9R unknown Het
Anks1b T A 10: 90,967,018 S398T probably benign Het
Bbox1 T A 2: 110,292,526 K139N probably benign Het
Birc6 C A 17: 74,641,671 H3047N probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camta1 G A 4: 151,835,876 S18F probably damaging Het
Ccnb1ip1 T C 14: 50,793,820 Y12C possibly damaging Het
Celsr3 G A 9: 108,828,072 A585T probably benign Het
Col6a4 T C 9: 106,080,298 N109S probably benign Het
Crisp4 A T 1: 18,128,669 D180E probably benign Het
D230025D16Rik C A 8: 105,249,452 T347N probably benign Het
Dmxl1 T A 18: 49,864,383 M546K probably damaging Het
Dnah11 C T 12: 117,987,502 V3024I probably benign Het
Dnah2 T C 11: 69,431,238 D3752G probably damaging Het
Dram1 G T 10: 88,324,747 D237E probably benign Het
Ehbp1l1 T C 19: 5,719,398 N626D probably benign Het
Elavl1 T G 8: 4,311,763 N3T probably damaging Het
Fam184a A G 10: 53,698,493 V340A probably benign Het
Fam205a1 C T 4: 42,851,586 C190Y probably benign Het
Fam35a A T 14: 34,267,767 M394K possibly damaging Het
Fer1l5 C T 1: 36,407,036 T876M not run Het
Foxp2 T A 6: 15,409,889 V471E unknown Het
Fstl5 G A 3: 76,536,298 G317R probably damaging Het
Gm30302 A G 13: 49,790,071 S44P possibly damaging Het
Gm32742 T C 9: 51,149,114 E963G possibly damaging Het
Gpbp1 A T 13: 111,439,199 S257T possibly damaging Het
Gsdmc4 C T 15: 63,897,719 C218Y possibly damaging Het
Hmg20b T C 10: 81,346,608 H298R probably damaging Het
Igf2r A T 17: 12,748,704 C72S probably benign Het
Kcnip1 A G 11: 33,633,206 M193T probably damaging Het
Khdc1c G T 1: 21,369,675 C150F probably benign Het
Kmt2b A G 7: 30,579,783 S1485P probably damaging Het
Lnpep A G 17: 17,566,739 S533P probably benign Het
Megf8 T A 7: 25,340,635 V997E possibly damaging Het
Mob2 T C 7: 142,009,440 Y94C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Npepl1 A G 2: 174,120,594 D351G probably damaging Het
Nrg1 G A 8: 31,838,324 Q213* probably null Het
Nrp2 A G 1: 62,771,831 D677G probably benign Het
Olfr1033 C A 2: 86,041,470 Q52K probably benign Het
Olfr124 G T 17: 37,805,429 G95C probably damaging Het
Olfr143 T A 9: 38,254,110 M228K probably benign Het
Olfr259 G T 2: 87,108,057 T110K probably damaging Het
Olfr679 G T 7: 105,086,573 V286F probably damaging Het
Olfr746 A G 14: 50,653,447 E70G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Prune2 G A 19: 17,123,029 V1966I possibly damaging Het
Ptch2 A G 4: 117,110,388 H751R probably benign Het
Ptges2 T A 2: 32,402,231 M353K probably damaging Het
Pum3 G A 19: 27,396,328 Q564* probably null Het
Qtrt1 A G 9: 21,419,341 D279G probably damaging Het
Rftn1 C T 17: 50,047,435 V300I probably benign Het
Robo2 T C 16: 73,920,697 T1172A probably benign Het
Sdc3 A G 4: 130,816,933 D74G unknown Het
Setd1b A G 5: 123,152,273 M768V unknown Het
Siglech A T 7: 55,772,541 H298L probably benign Het
Sipa1 A T 19: 5,651,676 L977Q probably damaging Het
Slc9c1 G A 16: 45,582,969 V800I probably benign Het
Tbc1d8 C T 1: 39,386,023 R582Q probably damaging Het
Tmem247 T A 17: 86,922,300 F190I probably damaging Het
Trim42 C A 9: 97,363,017 A577S possibly damaging Het
Ubiad1 G A 4: 148,444,269 T61I probably benign Het
Usp40 G A 1: 87,995,713 Q279* probably null Het
Usp48 A G 4: 137,633,455 N733S probably benign Het
Vmn2r83 A T 10: 79,478,427 I170F probably benign Het
Xkr4 G A 1: 3,216,264 P568S probably damaging Het
Zc3h7b T C 15: 81,780,478 W513R probably damaging Het
Zfp40 T C 17: 23,191,466 probably benign Het
Zfp652 T A 11: 95,750,109 S287T possibly damaging Het
Znrf3 G A 11: 5,444,533 A49V unknown Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77323358 splice site probably benign
IGL01154:2210408I21Rik APN 13 77281094 missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77281095 missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77193086 missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77259876 missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77260031 missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77174872 missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77261955 missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77267699 missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77323772 critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77259997 missense probably benign
IGL03184:2210408I21Rik APN 13 77323451 missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77298555 missense possibly damaging 0.71
PIT4651001:2210408I21Rik UTSW 13 77259895 missense probably benign
R0226:2210408I21Rik UTSW 13 77303425 missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77298555 missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77192663 missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77323607 missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77334287 missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77192647 missense probably benign
R1711:2210408I21Rik UTSW 13 77269920 missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77316360 missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77245370 intron probably benign
R1836:2210408I21Rik UTSW 13 77323374 missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77267809 missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77612642 makesense probably null
R2329:2210408I21Rik UTSW 13 77303325 missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77323521 missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77267849 missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77193173 missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4388:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77316527 missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77254256 intron probably null
R4798:2210408I21Rik UTSW 13 77323724 missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77245327 missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77267808 synonymous probably null
R5387:2210408I21Rik UTSW 13 77259973 missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77303389 missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77303314 missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77327902 missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77254216 missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77183731 missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77262111 missense probably benign
R6588:2210408I21Rik UTSW 13 77192647 missense probably benign
R6632:2210408I21Rik UTSW 13 77281067 missense possibly damaging 0.86
R6638:2210408I21Rik UTSW 13 77303402 missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77327875 missense probably benign
R6971:2210408I21Rik UTSW 13 77193187 missense possibly damaging 0.90
R7079:2210408I21Rik UTSW 13 77254204 missense possibly damaging 0.86
R7130:2210408I21Rik UTSW 13 77269902 missense possibly damaging 0.93
R7215:2210408I21Rik UTSW 13 77323571 missense possibly damaging 0.96
R7272:2210408I21Rik UTSW 13 77323536 missense probably benign 0.00
R7331:2210408I21Rik UTSW 13 77183609 missense possibly damaging 0.53
R7561:2210408I21Rik UTSW 13 77193195 missense probably benign
R7684:2210408I21Rik UTSW 13 77612540 nonsense probably null
R7728:2210408I21Rik UTSW 13 77316477 missense possibly damaging 0.96
R7964:2210408I21Rik UTSW 13 77323566 missense possibly damaging 0.53
R8008:2210408I21Rik UTSW 13 77281115 missense probably benign 0.28
R8024:2210408I21Rik UTSW 13 77612594 missense probably benign
X0066:2210408I21Rik UTSW 13 77183640 missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77174891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGTCTATTGTCCTCAGC -3'
(R):5'- GAGAGACAGGCATGGCTTTACC -3'

Sequencing Primer
(F):5'- CCTCAGCAAGTTACCTACAGTGATTG -3'
(R):5'- ACCATTGGATGCTCAGTGTC -3'
Posted On2019-12-20