Incidental Mutation 'R7881:Zc3h7b'
ID608784
Institutional Source Beutler Lab
Gene Symbol Zc3h7b
Ensembl Gene ENSMUSG00000022390
Gene Namezinc finger CCCH type containing 7B
SynonymsScrg3
MMRRC Submission
Accession Numbers

Genbank: NM_001081016; MGI: 1328310

Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R7881 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location81745057-81796260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81780478 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 513 (W513R)
Ref Sequence ENSEMBL: ENSMUSP00000105181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109554]
Predicted Effect probably damaging
Transcript: ENSMUST00000109554
AA Change: W513R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105181
Gene: ENSMUSG00000022390
AA Change: W513R

DomainStartEndE-ValueType
Pfam:TPR_11 34 113 2.3e-12 PFAM
Pfam:TPR_1 82 115 2.4e-6 PFAM
Pfam:TPR_8 82 115 8.2e-4 PFAM
Pfam:TPR_8 116 143 4.8e-3 PFAM
low complexity region 294 309 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C3H1 482 508 2.15e1 SMART
ZnF_C3H1 612 638 2.03e1 SMART
ZnF_C3H1 757 782 8.31e0 SMART
ZnF_C2H2 843 867 2.86e-1 SMART
ZnF_C3H1 889 914 7.81e-1 SMART
low complexity region 959 981 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a tetratricopeptide repeat domain. The encoded protein also interacts with the rotavirus non-structural protein NSP3. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(9) : Gene trapped(9)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,323,566 N1030S possibly damaging Het
4930507D05Rik A G 10: 62,449,524 H9R unknown Het
Anks1b T A 10: 90,967,018 S398T probably benign Het
Bbox1 T A 2: 110,292,526 K139N probably benign Het
Birc6 C A 17: 74,641,671 H3047N probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camta1 G A 4: 151,835,876 S18F probably damaging Het
Ccnb1ip1 T C 14: 50,793,820 Y12C possibly damaging Het
Celsr3 G A 9: 108,828,072 A585T probably benign Het
Col6a4 T C 9: 106,080,298 N109S probably benign Het
Crisp4 A T 1: 18,128,669 D180E probably benign Het
D230025D16Rik C A 8: 105,249,452 T347N probably benign Het
Dmxl1 T A 18: 49,864,383 M546K probably damaging Het
Dnah11 C T 12: 117,987,502 V3024I probably benign Het
Dnah2 T C 11: 69,431,238 D3752G probably damaging Het
Dram1 G T 10: 88,324,747 D237E probably benign Het
Ehbp1l1 T C 19: 5,719,398 N626D probably benign Het
Elavl1 T G 8: 4,311,763 N3T probably damaging Het
Fam184a A G 10: 53,698,493 V340A probably benign Het
Fam205a1 C T 4: 42,851,586 C190Y probably benign Het
Fam35a A T 14: 34,267,767 M394K possibly damaging Het
Fer1l5 C T 1: 36,407,036 T876M not run Het
Foxp2 T A 6: 15,409,889 V471E unknown Het
Fstl5 G A 3: 76,536,298 G317R probably damaging Het
Gm30302 A G 13: 49,790,071 S44P possibly damaging Het
Gm32742 T C 9: 51,149,114 E963G possibly damaging Het
Gpbp1 A T 13: 111,439,199 S257T possibly damaging Het
Gsdmc4 C T 15: 63,897,719 C218Y possibly damaging Het
Hmg20b T C 10: 81,346,608 H298R probably damaging Het
Igf2r A T 17: 12,748,704 C72S probably benign Het
Kcnip1 A G 11: 33,633,206 M193T probably damaging Het
Khdc1c G T 1: 21,369,675 C150F probably benign Het
Kmt2b A G 7: 30,579,783 S1485P probably damaging Het
Lnpep A G 17: 17,566,739 S533P probably benign Het
Megf8 T A 7: 25,340,635 V997E possibly damaging Het
Mob2 T C 7: 142,009,440 Y94C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Npepl1 A G 2: 174,120,594 D351G probably damaging Het
Nrg1 G A 8: 31,838,324 Q213* probably null Het
Nrp2 A G 1: 62,771,831 D677G probably benign Het
Olfr1033 C A 2: 86,041,470 Q52K probably benign Het
Olfr124 G T 17: 37,805,429 G95C probably damaging Het
Olfr143 T A 9: 38,254,110 M228K probably benign Het
Olfr259 G T 2: 87,108,057 T110K probably damaging Het
Olfr679 G T 7: 105,086,573 V286F probably damaging Het
Olfr746 A G 14: 50,653,447 E70G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Prune2 G A 19: 17,123,029 V1966I possibly damaging Het
Ptch2 A G 4: 117,110,388 H751R probably benign Het
Ptges2 T A 2: 32,402,231 M353K probably damaging Het
Pum3 G A 19: 27,396,328 Q564* probably null Het
Qtrt1 A G 9: 21,419,341 D279G probably damaging Het
Rftn1 C T 17: 50,047,435 V300I probably benign Het
Robo2 T C 16: 73,920,697 T1172A probably benign Het
Sdc3 A G 4: 130,816,933 D74G unknown Het
Setd1b A G 5: 123,152,273 M768V unknown Het
Siglech A T 7: 55,772,541 H298L probably benign Het
Sipa1 A T 19: 5,651,676 L977Q probably damaging Het
Slc9c1 G A 16: 45,582,969 V800I probably benign Het
Tbc1d8 C T 1: 39,386,023 R582Q probably damaging Het
Tmem247 T A 17: 86,922,300 F190I probably damaging Het
Trim42 C A 9: 97,363,017 A577S possibly damaging Het
Ubiad1 G A 4: 148,444,269 T61I probably benign Het
Usp40 G A 1: 87,995,713 Q279* probably null Het
Usp48 A G 4: 137,633,455 N733S probably benign Het
Vmn2r83 A T 10: 79,478,427 I170F probably benign Het
Xkr4 G A 1: 3,216,264 P568S probably damaging Het
Zfp40 T C 17: 23,191,466 probably benign Het
Zfp652 T A 11: 95,750,109 S287T possibly damaging Het
Znrf3 G A 11: 5,444,533 A49V unknown Het
Other mutations in Zc3h7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Zc3h7b APN 15 81771799 missense possibly damaging 0.95
IGL01955:Zc3h7b APN 15 81792004 missense probably benign 0.10
IGL02526:Zc3h7b APN 15 81793137 missense probably benign 0.10
IGL02582:Zc3h7b APN 15 81769140 missense probably benign 0.05
IGL02736:Zc3h7b APN 15 81791974 missense probably benign 0.02
F6893:Zc3h7b UTSW 15 81778671 missense possibly damaging 0.94
R0212:Zc3h7b UTSW 15 81776328 missense probably benign 0.00
R0242:Zc3h7b UTSW 15 81768830 splice site probably benign
R0471:Zc3h7b UTSW 15 81781968 missense probably damaging 1.00
R0590:Zc3h7b UTSW 15 81776998 missense possibly damaging 0.74
R1530:Zc3h7b UTSW 15 81777088 missense probably benign
R1563:Zc3h7b UTSW 15 81777088 missense probably benign
R1565:Zc3h7b UTSW 15 81777088 missense probably benign
R1566:Zc3h7b UTSW 15 81768834 missense possibly damaging 0.91
R1670:Zc3h7b UTSW 15 81777067 missense probably benign
R1712:Zc3h7b UTSW 15 81777088 missense probably benign
R1727:Zc3h7b UTSW 15 81768029 missense probably damaging 1.00
R2069:Zc3h7b UTSW 15 81792328 missense probably damaging 0.98
R2375:Zc3h7b UTSW 15 81792502 missense probably benign 0.17
R2656:Zc3h7b UTSW 15 81780430 missense probably damaging 1.00
R4660:Zc3h7b UTSW 15 81792250 missense probably benign 0.07
R4764:Zc3h7b UTSW 15 81769183 critical splice donor site probably null
R4815:Zc3h7b UTSW 15 81793663 missense probably damaging 1.00
R4999:Zc3h7b UTSW 15 81779133 missense probably damaging 1.00
R5086:Zc3h7b UTSW 15 81793174 missense probably damaging 0.96
R5169:Zc3h7b UTSW 15 81773314 missense probably benign 0.01
R5395:Zc3h7b UTSW 15 81772501 missense possibly damaging 0.50
R5407:Zc3h7b UTSW 15 81785891 missense probably damaging 0.99
R5587:Zc3h7b UTSW 15 81771858 missense possibly damaging 0.80
R5721:Zc3h7b UTSW 15 81773298 missense probably benign 0.02
R6001:Zc3h7b UTSW 15 81792035 missense possibly damaging 0.89
R6151:Zc3h7b UTSW 15 81778710 critical splice donor site probably null
R6248:Zc3h7b UTSW 15 81783185 missense probably damaging 1.00
R6397:Zc3h7b UTSW 15 81792854 missense probably benign 0.03
R6502:Zc3h7b UTSW 15 81769051 missense probably benign 0.01
R7248:Zc3h7b UTSW 15 81771787 missense possibly damaging 0.46
R7397:Zc3h7b UTSW 15 81769153 missense possibly damaging 0.50
R7450:Zc3h7b UTSW 15 81783080 missense probably benign
R7471:Zc3h7b UTSW 15 81780481 missense probably damaging 1.00
R7575:Zc3h7b UTSW 15 81777885 nonsense probably null
R7645:Zc3h7b UTSW 15 81780602 missense probably damaging 1.00
R7650:Zc3h7b UTSW 15 81793650 missense possibly damaging 0.81
R7918:Zc3h7b UTSW 15 81768988 missense probably damaging 0.98
R8001:Zc3h7b UTSW 15 81779260 nonsense probably null
R8504:Zc3h7b UTSW 15 81780518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTGGACATTGGCAGCC -3'
(R):5'- TAATGGCTCCTGACTGTGC -3'

Sequencing Primer
(F):5'- ATTGGCAGCCACCAGTG -3'
(R):5'- TCCTGACTGTGCTGGGGAC -3'
Posted On2019-12-20