Incidental Mutation 'R7882:Adgra2'
ID 608825
Institutional Source Beutler Lab
Gene Symbol Adgra2
Ensembl Gene ENSMUSG00000031486
Gene Name adhesion G protein-coupled receptor A2
Synonyms Tem5, 8430414O08Rik, Gpr124, 9530074E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7882 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 27085583-27123436 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27117412 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 717 (D717G)
Ref Sequence ENSEMBL: ENSMUSP00000033876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033876] [ENSMUST00000178514] [ENSMUST00000179351]
AlphaFold Q91ZV8
Predicted Effect probably benign
Transcript: ENSMUST00000033876
AA Change: D717G

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033876
Gene: ENSMUSG00000031486
AA Change: D717G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 1.06e2 SMART
LRR_TYP 107 130 2.71e-2 SMART
LRR_TYP 131 154 1.28e-3 SMART
LRR 155 178 7.38e1 SMART
LRRCT 190 240 4.63e-6 SMART
IG 253 346 3.49e-3 SMART
low complexity region 629 639 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Pfam:GPS 709 750 1.1e-7 PFAM
Pfam:7tm_2 770 990 5.3e-13 PFAM
transmembrane domain 1016 1038 N/A INTRINSIC
transmembrane domain 1045 1064 N/A INTRINSIC
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1110 1129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178514
SMART Domains Protein: ENSMUSP00000136277
Gene: ENSMUSG00000031486

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 4.4e-1 SMART
LRR_TYP 107 130 1.1e-4 SMART
LRR_TYP 131 154 5.3e-6 SMART
LRR 155 178 3.1e-1 SMART
LRRCT 190 240 2.2e-8 SMART
IG 253 346 1.4e-5 SMART
HormR 349 426 1.8e-4 SMART
Pfam:7tm_2 554 775 3.2e-11 PFAM
transmembrane domain 801 823 N/A INTRINSIC
transmembrane domain 830 849 N/A INTRINSIC
low complexity region 860 880 N/A INTRINSIC
low complexity region 895 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179207
Predicted Effect probably damaging
Transcript: ENSMUST00000179351
AA Change: D15G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137457
Gene: ENSMUSG00000031486
AA Change: D15G

DomainStartEndE-ValueType
Pfam:GPS 5 49 4.5e-11 PFAM
transmembrane domain 67 89 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display fetal or perinatal lethality with CNS hemorrhage and angiogenic arrest in the CNS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm C A 3: 153,938,613 E110* probably null Het
Adad1 G T 3: 37,079,802 V289F probably damaging Het
Arid3b T C 9: 57,796,497 I389M possibly damaging Het
Axdnd1 A G 1: 156,397,453 V47A Het
Cachd1 T A 4: 100,967,047 L562M probably benign Het
Cadm2 A T 16: 66,731,471 I326N probably benign Het
Ccpg1 T C 9: 73,015,505 F799S probably damaging Het
Ces1c T C 8: 93,106,603 I411M probably benign Het
Cgn T G 3: 94,762,634 K1066N probably damaging Het
Cntn4 A G 6: 106,353,723 I101V probably benign Het
Cntrl A G 2: 35,170,580 E1928G probably benign Het
Cxcl12 A G 6: 117,171,503 Y28C probably damaging Het
Cyp2r1 A T 7: 114,554,589 probably null Het
D430041D05Rik C T 2: 104,257,629 W334* probably null Het
Dsp G A 13: 38,184,018 R671Q possibly damaging Het
Fancm A G 12: 65,126,794 K1960R probably benign Het
Fgd5 T A 6: 92,068,478 Y1331N probably damaging Het
Ina G A 19: 47,015,661 E303K Het
Kctd3 C A 1: 188,983,046 V369F possibly damaging Het
Kif14 T C 1: 136,471,576 probably null Het
Kif14 T C 1: 136,516,025 V1312A probably benign Het
Krt84 T C 15: 101,528,391 I403V probably benign Het
Krtap9-1 A C 11: 99,873,530 T31P unknown Het
Lyrm9 A T 11: 78,838,141 I60F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mmp28 T C 11: 83,443,926 D334G probably damaging Het
Nr1h5 T C 3: 102,949,615 T194A possibly damaging Het
Nrf1 A G 6: 30,090,300 I85M probably benign Het
Nrp2 C T 1: 62,783,521 R758C probably damaging Het
Olfr1471 A T 19: 13,445,587 T192S probably benign Het
Pcdhga4 A G 18: 37,686,628 D410G probably damaging Het
Pld1 T C 3: 28,045,009 V275A probably damaging Het
Plxnc1 A T 10: 94,843,836 F895I probably benign Het
Polr2a A G 11: 69,736,174 I1486T possibly damaging Het
Ptprz1 A G 6: 23,002,257 M1449V probably benign Het
Rspo4 C A 2: 151,869,826 T156N probably damaging Het
Sacs A G 14: 61,207,071 I2189V probably benign Het
Stat5b A C 11: 100,783,775 F711V possibly damaging Het
Stk11ip C A 1: 75,529,464 Q543K probably benign Het
Tarbp1 G A 8: 126,456,493 T529M probably damaging Het
Thada A T 17: 84,429,196 C886S possibly damaging Het
Tmem19 A G 10: 115,343,703 F296S probably benign Het
Tnfsf13b A G 8: 10,007,078 N79S not run Het
Vdac3 C A 8: 22,579,057 G214C probably damaging Het
Vmn2r18 A C 5: 151,561,864 F722V probably damaging Het
Vmn2r45 A G 7: 8,483,410 L293S possibly damaging Het
Vmn2r88 C G 14: 51,413,046 A72G probably benign Het
Xpot A G 10: 121,619,091 probably null Het
Zfp526 G A 7: 25,221,435 probably benign Het
Zfp532 A G 18: 65,623,490 T165A probably benign Het
Other mutations in Adgra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Adgra2 APN 8 27085983 missense possibly damaging 0.81
IGL01599:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01627:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01629:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01632:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01968:Adgra2 APN 8 27121235 nonsense probably null
IGL02551:Adgra2 APN 8 27119222 missense probably benign
IGL02820:Adgra2 APN 8 27117507 missense probably damaging 1.00
R0735:Adgra2 UTSW 8 27117318 missense probably damaging 1.00
R0799:Adgra2 UTSW 8 27112495 missense probably damaging 1.00
R1183:Adgra2 UTSW 8 27114388 missense probably damaging 1.00
R1276:Adgra2 UTSW 8 27119824 missense probably damaging 0.99
R1389:Adgra2 UTSW 8 27111088 missense probably damaging 1.00
R1514:Adgra2 UTSW 8 27121278 nonsense probably null
R1601:Adgra2 UTSW 8 27110018 splice site probably null
R1760:Adgra2 UTSW 8 27119767 missense probably damaging 1.00
R1957:Adgra2 UTSW 8 27111168 missense possibly damaging 0.64
R1977:Adgra2 UTSW 8 27115761 missense possibly damaging 0.80
R2164:Adgra2 UTSW 8 27114204 nonsense probably null
R2181:Adgra2 UTSW 8 27121673 missense probably damaging 0.99
R4282:Adgra2 UTSW 8 27119244 missense possibly damaging 0.54
R4724:Adgra2 UTSW 8 27098822 missense possibly damaging 0.91
R4749:Adgra2 UTSW 8 27114197 missense probably damaging 1.00
R4809:Adgra2 UTSW 8 27110479 nonsense probably null
R5718:Adgra2 UTSW 8 27113486 critical splice donor site probably null
R6025:Adgra2 UTSW 8 27114463 missense probably damaging 0.99
R6078:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6079:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6138:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6140:Adgra2 UTSW 8 27115405 missense probably damaging 1.00
R6232:Adgra2 UTSW 8 27119165 missense probably benign 0.19
R6321:Adgra2 UTSW 8 27114162 missense probably benign 0.02
R6385:Adgra2 UTSW 8 27118850 missense probably damaging 1.00
R6676:Adgra2 UTSW 8 27111240 missense possibly damaging 0.50
R6724:Adgra2 UTSW 8 27114182 missense possibly damaging 0.93
R6862:Adgra2 UTSW 8 27113436 missense probably benign 0.01
R6862:Adgra2 UTSW 8 27113437 missense probably damaging 0.98
R7140:Adgra2 UTSW 8 27120901 critical splice donor site probably null
R7242:Adgra2 UTSW 8 27122027 missense probably damaging 1.00
R7861:Adgra2 UTSW 8 27114457 missense probably damaging 0.98
R8069:Adgra2 UTSW 8 27119223 missense probably benign 0.01
R8146:Adgra2 UTSW 8 27114174 missense probably damaging 0.99
R9080:Adgra2 UTSW 8 27114501 missense probably benign 0.02
R9103:Adgra2 UTSW 8 27113408 missense probably damaging 1.00
R9135:Adgra2 UTSW 8 27120951 missense probably damaging 1.00
R9425:Adgra2 UTSW 8 27086066 missense probably benign 0.04
R9473:Adgra2 UTSW 8 27120915 missense probably damaging 0.99
R9643:Adgra2 UTSW 8 27122003 missense possibly damaging 0.48
R9648:Adgra2 UTSW 8 27119144 missense probably damaging 1.00
X0050:Adgra2 UTSW 8 27113418 missense probably benign 0.32
X0062:Adgra2 UTSW 8 27120806 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TAGTTCTGTCCCCAGGTCAG -3'
(R):5'- GCTTCAAGTGATCAAAGTCCCC -3'

Sequencing Primer
(F):5'- AGGTCAGCAGTGTCTGTCC -3'
(R):5'- AGTCCCTACCTCCCACACATATTTC -3'
Posted On 2019-12-20