Mutagenetix > Incidental Mutation

Incidental Mutation 'R7882:Tarbp1'

608828

Institutional Source

Beutler Lab

Gene Symbol

Tarbp1

Ensembl Gene

ENSMUSG00000090290

Gene Name

TAR RNA binding protein 1

Synonyms

Gm17296

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7882 (G1)

Quality Score

177.009

Status

Validated

Chromosome

Chromosomal Location

126425329-126475065 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 126456493 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 529 (T529M)

Ref Sequence

ENSEMBL: ENSMUSP00000129815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170518]

AlphaFold

E9Q368

Predicted Effect

probably damaging
Transcript: ENSMUST00000170518
AA Change: T529M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: T529M

Domain	Start	End	E-Value	Type
low complexity region	17	31	N/A	INTRINSIC
low complexity region	47	57	N/A	INTRINSIC
low complexity region	77	97	N/A	INTRINSIC
low complexity region	112	127	N/A	INTRINSIC
low complexity region	195	207	N/A	INTRINSIC
SCOP:d1gw5a_	1059	1260	3e-3	SMART
Pfam:SpoU_methylase	1421	1564	2.2e-32	PFAM

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	C	A	3: 153,938,613	E110*	probably null	Het
Adad1	G	T	3: 37,079,802	V289F	probably damaging	Het
Adgra2	A	G	8: 27,117,412	D717G	probably benign	Het
Arid3b	T	C	9: 57,796,497	I389M	possibly damaging	Het
Axdnd1	A	G	1: 156,397,453	V47A		Het
Cachd1	T	A	4: 100,967,047	L562M	probably benign	Het
Cadm2	A	T	16: 66,731,471	I326N	probably benign	Het
Ccpg1	T	C	9: 73,015,505	F799S	probably damaging	Het
Ces1c	T	C	8: 93,106,603	I411M	probably benign	Het
Cgn	T	G	3: 94,762,634	K1066N	probably damaging	Het
Cntn4	A	G	6: 106,353,723	I101V	probably benign	Het
Cntrl	A	G	2: 35,170,580	E1928G	probably benign	Het
Cxcl12	A	G	6: 117,171,503	Y28C	probably damaging	Het
Cyp2r1	A	T	7: 114,554,589		probably null	Het
D430041D05Rik	C	T	2: 104,257,629	W334*	probably null	Het
Dsp	G	A	13: 38,184,018	R671Q	possibly damaging	Het
Fancm	A	G	12: 65,126,794	K1960R	probably benign	Het
Fgd5	T	A	6: 92,068,478	Y1331N	probably damaging	Het
Ina	G	A	19: 47,015,661	E303K		Het
Kctd3	C	A	1: 188,983,046	V369F	possibly damaging	Het
Kif14	T	C	1: 136,471,576		probably null	Het
Kif14	T	C	1: 136,516,025	V1312A	probably benign	Het
Krt84	T	C	15: 101,528,391	I403V	probably benign	Het
Krtap9-1	A	C	11: 99,873,530	T31P	unknown	Het
Lyrm9	A	T	11: 78,838,141	I60F	probably damaging	Het
Mast1	A	G	8: 84,913,318		probably null	Het
Mmp28	T	C	11: 83,443,926	D334G	probably damaging	Het
Nr1h5	T	C	3: 102,949,615	T194A	possibly damaging	Het
Nrf1	A	G	6: 30,090,300	I85M	probably benign	Het
Nrp2	C	T	1: 62,783,521	R758C	probably damaging	Het
Olfr1471	A	T	19: 13,445,587	T192S	probably benign	Het
Pcdhga4	A	G	18: 37,686,628	D410G	probably damaging	Het
Pld1	T	C	3: 28,045,009	V275A	probably damaging	Het
Plxnc1	A	T	10: 94,843,836	F895I	probably benign	Het
Polr2a	A	G	11: 69,736,174	I1486T	possibly damaging	Het
Ptprz1	A	G	6: 23,002,257	M1449V	probably benign	Het
Rspo4	C	A	2: 151,869,826	T156N	probably damaging	Het
Sacs	A	G	14: 61,207,071	I2189V	probably benign	Het
Stat5b	A	C	11: 100,783,775	F711V	possibly damaging	Het
Stk11ip	C	A	1: 75,529,464	Q543K	probably benign	Het
Thada	A	T	17: 84,429,196	C886S	possibly damaging	Het
Tmem19	A	G	10: 115,343,703	F296S	probably benign	Het
Tnfsf13b	A	G	8: 10,007,078	N79S	not run	Het
Vdac3	C	A	8: 22,579,057	G214C	probably damaging	Het
Vmn2r18	A	C	5: 151,561,864	F722V	probably damaging	Het
Vmn2r45	A	G	7: 8,483,410	L293S	possibly damaging	Het
Vmn2r88	C	G	14: 51,413,046	A72G	probably benign	Het
Xpot	A	G	10: 121,619,091		probably null	Het
Zfp526	G	A	7: 25,221,435		probably benign	Het
Zfp532	A	G	18: 65,623,490	T165A	probably benign	Het

Other mutations in Tarbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Tarbp1	APN	8	126459161	missense	probably damaging	1.00
IGL01419:Tarbp1	APN	8	126428155	missense	probably benign	0.03
IGL01475:Tarbp1	APN	8	126433962	missense	probably benign	0.03
IGL01688:Tarbp1	APN	8	126447551	missense	probably damaging	1.00
IGL01772:Tarbp1	APN	8	126447231	splice site	probably benign
IGL02402:Tarbp1	APN	8	126450828	splice site	probably benign
IGL02899:Tarbp1	APN	8	126453844	missense	probably damaging	0.96
IGL03006:Tarbp1	APN	8	126444142	missense	probably damaging	1.00
IGL03273:Tarbp1	APN	8	126453835	missense	probably damaging	1.00
PIT4280001:Tarbp1	UTSW	8	126430847	missense	probably damaging	0.96
R0048:Tarbp1	UTSW	8	126447530	missense	probably damaging	1.00
R0309:Tarbp1	UTSW	8	126438928	splice site	probably benign
R0383:Tarbp1	UTSW	8	126447484	missense	probably benign	0.00
R0455:Tarbp1	UTSW	8	126440873	missense	probably benign	0.00
R0738:Tarbp1	UTSW	8	126438801	critical splice donor site	probably null
R1345:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1370:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1617:Tarbp1	UTSW	8	126444268	missense	possibly damaging	0.47
R1628:Tarbp1	UTSW	8	126430860	missense	possibly damaging	0.78
R1702:Tarbp1	UTSW	8	126428218	missense	probably damaging	1.00
R1873:Tarbp1	UTSW	8	126447047	missense	probably damaging	1.00
R2018:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2019:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2060:Tarbp1	UTSW	8	126447594	splice site	probably null
R2877:Tarbp1	UTSW	8	126427832	missense	probably damaging	1.00
R3008:Tarbp1	UTSW	8	126447421	missense	possibly damaging	0.46
R3875:Tarbp1	UTSW	8	126438799	splice site	probably benign
R3905:Tarbp1	UTSW	8	126428152	missense	probably damaging	1.00
R3923:Tarbp1	UTSW	8	126440771	missense	probably benign	0.00
R4420:Tarbp1	UTSW	8	126447080	missense	possibly damaging	0.59
R4570:Tarbp1	UTSW	8	126452233	missense	probably benign	0.00
R4610:Tarbp1	UTSW	8	126474330	missense	probably damaging	1.00
R4649:Tarbp1	UTSW	8	126447195	missense	probably damaging	0.96
R4802:Tarbp1	UTSW	8	126474889	missense	possibly damaging	0.75
R4951:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R4953:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R5254:Tarbp1	UTSW	8	126467156	missense	probably damaging	0.96
R5255:Tarbp1	UTSW	8	126428970	missense	probably benign	0.16
R5638:Tarbp1	UTSW	8	126450686	missense	probably damaging	1.00
R5696:Tarbp1	UTSW	8	126447340	missense	probably damaging	0.98
R5707:Tarbp1	UTSW	8	126467144	missense	probably damaging	1.00
R5896:Tarbp1	UTSW	8	126452928	missense	probably benign	0.05
R6087:Tarbp1	UTSW	8	126428970	missense	probably benign	0.00
R6117:Tarbp1	UTSW	8	126427541	missense	probably benign	0.00
R6132:Tarbp1	UTSW	8	126434809	missense	probably benign	0.17
R6168:Tarbp1	UTSW	8	126448405	missense	possibly damaging	0.89
R6419:Tarbp1	UTSW	8	126459044	missense	possibly damaging	0.95
R6482:Tarbp1	UTSW	8	126450695	missense	probably benign	0.01
R6766:Tarbp1	UTSW	8	126447400	missense	probably benign	0.41
R6775:Tarbp1	UTSW	8	126436829	missense	probably benign	0.16
R6960:Tarbp1	UTSW	8	126429039	missense	possibly damaging	0.88
R7054:Tarbp1	UTSW	8	126474495	missense	possibly damaging	0.85
R7068:Tarbp1	UTSW	8	126427034	missense	probably damaging	1.00
R7454:Tarbp1	UTSW	8	126457677	missense	probably benign	0.19
R7519:Tarbp1	UTSW	8	126433900	missense	possibly damaging	0.87
R7760:Tarbp1	UTSW	8	126452807	missense	not run
R7837:Tarbp1	UTSW	8	126474561	missense	probably benign	0.00
R7982:Tarbp1	UTSW	8	126444301	missense	probably damaging	1.00
R8166:Tarbp1	UTSW	8	126427128	missense	possibly damaging	0.79
R8517:Tarbp1	UTSW	8	126444195	missense	probably benign	0.29
R8838:Tarbp1	UTSW	8	126450830	splice site	probably benign
R8880:Tarbp1	UTSW	8	126471305	missense	probably damaging	1.00
R9061:Tarbp1	UTSW	8	126447141	missense	probably damaging	1.00
R9123:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9125:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9364:Tarbp1	UTSW	8	126450723	missense	probably benign	0.01
R9474:Tarbp1	UTSW	8	126429040	missense	probably benign	0.44
R9670:Tarbp1	UTSW	8	126456523	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGATACAATCTCATGGGGCC -3'
(R):5'- TGTGTACACTGAACGGGTC -3'

Sequencing Primer
(F):5'- CCGCCATTCATTGAAGTATGAGG -3'
(R):5'- GCTCCTGTACTTCTTTTGAAACAATG -3'

Posted On

2019-12-20