Incidental Mutation 'R7882:Tarbp1'
ID608828
Institutional Source Beutler Lab
Gene Symbol Tarbp1
Ensembl Gene ENSMUSG00000090290
Gene NameTAR RNA binding protein 1
SynonymsGm17296
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7882 (G1)
Quality Score177.009
Status Validated
Chromosome8
Chromosomal Location126425329-126475065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126456493 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 529 (T529M)
Ref Sequence ENSEMBL: ENSMUSP00000129815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170518]
Predicted Effect probably damaging
Transcript: ENSMUST00000170518
AA Change: T529M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: T529M

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
low complexity region 77 97 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
SCOP:d1gw5a_ 1059 1260 3e-3 SMART
Pfam:SpoU_methylase 1421 1564 2.2e-32 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm C A 3: 153,938,613 E110* probably null Het
Adad1 G T 3: 37,079,802 V289F probably damaging Het
Adgra2 A G 8: 27,117,412 D717G probably benign Het
Arid3b T C 9: 57,796,497 I389M possibly damaging Het
Axdnd1 A G 1: 156,397,453 V47A Het
Cachd1 T A 4: 100,967,047 L562M probably benign Het
Cadm2 A T 16: 66,731,471 I326N probably benign Het
Ccpg1 T C 9: 73,015,505 F799S probably damaging Het
Ces1c T C 8: 93,106,603 I411M probably benign Het
Cgn T G 3: 94,762,634 K1066N probably damaging Het
Cntn4 A G 6: 106,353,723 I101V probably benign Het
Cntrl A G 2: 35,170,580 E1928G probably benign Het
Cxcl12 A G 6: 117,171,503 Y28C probably damaging Het
Cyp2r1 A T 7: 114,554,589 probably null Het
D430041D05Rik C T 2: 104,257,629 W334* probably null Het
Dsp G A 13: 38,184,018 R671Q possibly damaging Het
Fancm A G 12: 65,126,794 K1960R probably benign Het
Fgd5 T A 6: 92,068,478 Y1331N probably damaging Het
Ina G A 19: 47,015,661 E303K Het
Kctd3 C A 1: 188,983,046 V369F possibly damaging Het
Kif14 T C 1: 136,471,576 probably null Het
Kif14 T C 1: 136,516,025 V1312A probably benign Het
Krt84 T C 15: 101,528,391 I403V probably benign Het
Krtap9-1 A C 11: 99,873,530 T31P unknown Het
Lyrm9 A T 11: 78,838,141 I60F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mmp28 T C 11: 83,443,926 D334G probably damaging Het
Nr1h5 T C 3: 102,949,615 T194A possibly damaging Het
Nrf1 A G 6: 30,090,300 I85M probably benign Het
Nrp2 C T 1: 62,783,521 R758C probably damaging Het
Olfr1471 A T 19: 13,445,587 T192S probably benign Het
Pcdhga4 A G 18: 37,686,628 D410G probably damaging Het
Pld1 T C 3: 28,045,009 V275A probably damaging Het
Plxnc1 A T 10: 94,843,836 F895I probably benign Het
Polr2a A G 11: 69,736,174 I1486T possibly damaging Het
Ptprz1 A G 6: 23,002,257 M1449V probably benign Het
Rspo4 C A 2: 151,869,826 T156N probably damaging Het
Sacs A G 14: 61,207,071 I2189V probably benign Het
Stat5b A C 11: 100,783,775 F711V possibly damaging Het
Stk11ip C A 1: 75,529,464 Q543K probably benign Het
Thada A T 17: 84,429,196 C886S possibly damaging Het
Tmem19 A G 10: 115,343,703 F296S probably benign Het
Tnfsf13b A G 8: 10,007,078 N79S not run Het
Vdac3 C A 8: 22,579,057 G214C probably damaging Het
Vmn2r18 A C 5: 151,561,864 F722V probably damaging Het
Vmn2r45 A G 7: 8,483,410 L293S possibly damaging Het
Vmn2r88 C G 14: 51,413,046 A72G probably benign Het
Xpot A G 10: 121,619,091 probably null Het
Zfp526 G A 7: 25,221,435 probably benign Het
Zfp532 A G 18: 65,623,490 T165A probably benign Het
Other mutations in Tarbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tarbp1 APN 8 126459161 missense probably damaging 1.00
IGL01419:Tarbp1 APN 8 126428155 missense probably benign 0.03
IGL01475:Tarbp1 APN 8 126433962 missense probably benign 0.03
IGL01688:Tarbp1 APN 8 126447551 missense probably damaging 1.00
IGL01772:Tarbp1 APN 8 126447231 splice site probably benign
IGL02402:Tarbp1 APN 8 126450828 splice site probably benign
IGL02899:Tarbp1 APN 8 126453844 missense probably damaging 0.96
IGL03006:Tarbp1 APN 8 126444142 missense probably damaging 1.00
IGL03273:Tarbp1 APN 8 126453835 missense probably damaging 1.00
PIT4280001:Tarbp1 UTSW 8 126430847 missense probably damaging 0.96
R0048:Tarbp1 UTSW 8 126447530 missense probably damaging 1.00
R0309:Tarbp1 UTSW 8 126438928 splice site probably benign
R0383:Tarbp1 UTSW 8 126447484 missense probably benign 0.00
R0455:Tarbp1 UTSW 8 126440873 missense probably benign 0.00
R0738:Tarbp1 UTSW 8 126438801 critical splice donor site probably null
R1345:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1370:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1617:Tarbp1 UTSW 8 126444268 missense possibly damaging 0.47
R1628:Tarbp1 UTSW 8 126430860 missense possibly damaging 0.78
R1702:Tarbp1 UTSW 8 126428218 missense probably damaging 1.00
R1873:Tarbp1 UTSW 8 126447047 missense probably damaging 1.00
R2018:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2019:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2060:Tarbp1 UTSW 8 126447594 splice site probably null
R2877:Tarbp1 UTSW 8 126427832 missense probably damaging 1.00
R3008:Tarbp1 UTSW 8 126447421 missense possibly damaging 0.46
R3875:Tarbp1 UTSW 8 126438799 splice site probably benign
R3905:Tarbp1 UTSW 8 126428152 missense probably damaging 1.00
R3923:Tarbp1 UTSW 8 126440771 missense probably benign 0.00
R4420:Tarbp1 UTSW 8 126447080 missense possibly damaging 0.59
R4570:Tarbp1 UTSW 8 126452233 missense probably benign 0.00
R4610:Tarbp1 UTSW 8 126474330 missense probably damaging 1.00
R4649:Tarbp1 UTSW 8 126447195 missense probably damaging 0.96
R4802:Tarbp1 UTSW 8 126474889 missense possibly damaging 0.75
R4951:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R4953:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R5254:Tarbp1 UTSW 8 126467156 missense probably damaging 0.96
R5255:Tarbp1 UTSW 8 126428970 missense probably benign 0.16
R5638:Tarbp1 UTSW 8 126450686 missense probably damaging 1.00
R5696:Tarbp1 UTSW 8 126447340 missense probably damaging 0.98
R5707:Tarbp1 UTSW 8 126467144 missense probably damaging 1.00
R5896:Tarbp1 UTSW 8 126452928 missense probably benign 0.05
R6087:Tarbp1 UTSW 8 126428970 missense probably benign 0.00
R6117:Tarbp1 UTSW 8 126427541 missense probably benign 0.00
R6132:Tarbp1 UTSW 8 126434809 missense probably benign 0.17
R6168:Tarbp1 UTSW 8 126448405 missense possibly damaging 0.89
R6419:Tarbp1 UTSW 8 126459044 missense possibly damaging 0.95
R6482:Tarbp1 UTSW 8 126450695 missense probably benign 0.01
R6766:Tarbp1 UTSW 8 126447400 missense probably benign 0.41
R6775:Tarbp1 UTSW 8 126436829 missense probably benign 0.16
R6960:Tarbp1 UTSW 8 126429039 missense possibly damaging 0.88
R7054:Tarbp1 UTSW 8 126474495 missense possibly damaging 0.85
R7068:Tarbp1 UTSW 8 126427034 missense probably damaging 1.00
R7454:Tarbp1 UTSW 8 126457677 missense probably benign 0.19
R7519:Tarbp1 UTSW 8 126433900 missense possibly damaging 0.87
R7760:Tarbp1 UTSW 8 126452807 missense not run
R7837:Tarbp1 UTSW 8 126474561 missense probably benign 0.00
R7982:Tarbp1 UTSW 8 126444301 missense probably damaging 1.00
R8166:Tarbp1 UTSW 8 126427128 missense possibly damaging 0.79
R8517:Tarbp1 UTSW 8 126444195 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGATACAATCTCATGGGGCC -3'
(R):5'- TGTGTACACTGAACGGGTC -3'

Sequencing Primer
(F):5'- CCGCCATTCATTGAAGTATGAGG -3'
(R):5'- GCTCCTGTACTTCTTTTGAAACAATG -3'
Posted On2019-12-20