Incidental Mutation 'R7882:Mmp28'
ID608836
Institutional Source Beutler Lab
Gene Symbol Mmp28
Ensembl Gene ENSMUSG00000020682
Gene Namematrix metallopeptidase 28 (epilysin)
Synonymsepilysin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7882 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location83440768-83463071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83443926 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 334 (D334G)
Ref Sequence ENSEMBL: ENSMUSP00000103772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021020] [ENSMUST00000037378] [ENSMUST00000103209] [ENSMUST00000108137] [ENSMUST00000119346] [ENSMUST00000188702]
Predicted Effect probably benign
Transcript: ENSMUST00000021020
SMART Domains Protein: ENSMUSP00000021020
Gene: ENSMUSG00000020682

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 1e-11 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 361 7.46e0 SMART
HX 363 406 1.64e-1 SMART
HX 408 454 1.78e-2 SMART
HX 456 500 5.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037378
SMART Domains Protein: ENSMUSP00000042098
Gene: ENSMUSG00000035085

DomainStartEndE-ValueType
Pfam:DUF4637 5 169 1.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103209
SMART Domains Protein: ENSMUSP00000099498
Gene: ENSMUSG00000020682

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 9.7e-12 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 349 392 1.64e-1 SMART
HX 394 440 1.78e-2 SMART
HX 442 486 5.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108137
AA Change: D334G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103772
Gene: ENSMUSG00000020682
AA Change: D334G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 2.6e-11 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 371 2.72e-7 SMART
HX 373 416 1.64e-1 SMART
HX 418 464 1.78e-2 SMART
HX 466 510 5.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119346
AA Change: D334G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112566
Gene: ENSMUSG00000020682
AA Change: D334G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 7.4e-12 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 371 2.72e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188702
SMART Domains Protein: ENSMUSP00000140664
Gene: ENSMUSG00000035085

DomainStartEndE-ValueType
Pfam:DUF4637 6 111 2.8e-48 PFAM
Meta Mutation Damage Score 0.3192 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix for both normal physiological processes, such as embryonic development, reproduction and tissue remodeling, and disease processes, such as asthma and metastasis. This gene encodes a secreted enzyme that degrades casein. Its expression pattern suggests that it plays a role in tissue homeostasis and in wound repair. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Null homozygote mice have enhanced chemotaxis of macrophages into the lung upon infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm C A 3: 153,938,613 E110* probably null Het
Adad1 G T 3: 37,079,802 V289F probably damaging Het
Adgra2 A G 8: 27,117,412 D717G probably benign Het
Arid3b T C 9: 57,796,497 I389M possibly damaging Het
Axdnd1 A G 1: 156,397,453 V47A Het
Cachd1 T A 4: 100,967,047 L562M probably benign Het
Cadm2 A T 16: 66,731,471 I326N probably benign Het
Ccpg1 T C 9: 73,015,505 F799S probably damaging Het
Ces1c T C 8: 93,106,603 I411M probably benign Het
Cgn T G 3: 94,762,634 K1066N probably damaging Het
Cntn4 A G 6: 106,353,723 I101V probably benign Het
Cntrl A G 2: 35,170,580 E1928G probably benign Het
Cxcl12 A G 6: 117,171,503 Y28C probably damaging Het
Cyp2r1 A T 7: 114,554,589 probably null Het
D430041D05Rik C T 2: 104,257,629 W334* probably null Het
Dsp G A 13: 38,184,018 R671Q possibly damaging Het
Fancm A G 12: 65,126,794 K1960R probably benign Het
Fgd5 T A 6: 92,068,478 Y1331N probably damaging Het
Ina G A 19: 47,015,661 E303K Het
Kctd3 C A 1: 188,983,046 V369F possibly damaging Het
Kif14 T C 1: 136,471,576 probably null Het
Kif14 T C 1: 136,516,025 V1312A probably benign Het
Krt84 T C 15: 101,528,391 I403V probably benign Het
Krtap9-1 A C 11: 99,873,530 T31P unknown Het
Lyrm9 A T 11: 78,838,141 I60F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Nr1h5 T C 3: 102,949,615 T194A possibly damaging Het
Nrf1 A G 6: 30,090,300 I85M probably benign Het
Nrp2 C T 1: 62,783,521 R758C probably damaging Het
Olfr1471 A T 19: 13,445,587 T192S probably benign Het
Pcdhga4 A G 18: 37,686,628 D410G probably damaging Het
Pld1 T C 3: 28,045,009 V275A probably damaging Het
Plxnc1 A T 10: 94,843,836 F895I probably benign Het
Polr2a A G 11: 69,736,174 I1486T possibly damaging Het
Ptprz1 A G 6: 23,002,257 M1449V probably benign Het
Rspo4 C A 2: 151,869,826 T156N probably damaging Het
Sacs A G 14: 61,207,071 I2189V probably benign Het
Stat5b A C 11: 100,783,775 F711V possibly damaging Het
Stk11ip C A 1: 75,529,464 Q543K probably benign Het
Tarbp1 G A 8: 126,456,493 T529M probably damaging Het
Thada A T 17: 84,429,196 C886S possibly damaging Het
Tmem19 A G 10: 115,343,703 F296S probably benign Het
Tnfsf13b A G 8: 10,007,078 N79S not run Het
Vdac3 C A 8: 22,579,057 G214C probably damaging Het
Vmn2r18 A C 5: 151,561,864 F722V probably damaging Het
Vmn2r45 A G 7: 8,483,410 L293S possibly damaging Het
Vmn2r88 C G 14: 51,413,046 A72G probably benign Het
Xpot A G 10: 121,619,091 probably null Het
Zfp526 G A 7: 25,221,435 probably benign Het
Zfp532 A G 18: 65,623,490 T165A probably benign Het
Other mutations in Mmp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Mmp28 APN 11 83443776 missense possibly damaging 0.93
IGL02559:Mmp28 APN 11 83447740 missense probably benign 0.00
R0399:Mmp28 UTSW 11 83451732 missense probably damaging 1.00
R0492:Mmp28 UTSW 11 83443803 missense probably damaging 1.00
R1432:Mmp28 UTSW 11 83442939 missense probably damaging 1.00
R1822:Mmp28 UTSW 11 83444219 missense probably damaging 0.99
R2181:Mmp28 UTSW 11 83442717 missense possibly damaging 0.92
R5346:Mmp28 UTSW 11 83442663 missense probably benign
R5532:Mmp28 UTSW 11 83442858 missense probably damaging 1.00
R5548:Mmp28 UTSW 11 83443907 nonsense probably null
R7580:Mmp28 UTSW 11 83444832 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTGACTCAAGGCTGGTAC -3'
(R):5'- TCCAGAGCTGAATTACAAGGTGTG -3'

Sequencing Primer
(F):5'- CCTTTAAAGAAGTAGAAGTCTCCATC -3'
(R):5'- TGGGGAGATCTAGGATATAGAAATCC -3'
Posted On2019-12-20