Incidental Mutation 'R7882:Thada'
ID608844
Institutional Source Beutler Lab
Gene Symbol Thada
Ensembl Gene ENSMUSG00000024251
Gene Namethyroid adenoma associated
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7882 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location84190056-84466196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84429196 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 886 (C886S)
Ref Sequence ENSEMBL: ENSMUSP00000041701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047524]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047524
AA Change: C886S

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041701
Gene: ENSMUSG00000024251
AA Change: C886S

DomainStartEndE-ValueType
SCOP:d1gw5a_ 457 926 3e-6 SMART
Pfam:DUF2428 938 1239 1.6e-93 PFAM
SCOP:d1gw5a_ 1343 1802 7e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the target of 2p21 choromosomal aberrations in benign thyroid adenomas. Single nucleotide polymorphisms (SNPs) in this gene may be associated with type 2 diabetes and polycystic ovary syndrome. The encoded protein is likely involved in the death receptor pathway and apoptosis. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm C A 3: 153,938,613 E110* probably null Het
Adad1 G T 3: 37,079,802 V289F probably damaging Het
Adgra2 A G 8: 27,117,412 D717G probably benign Het
Arid3b T C 9: 57,796,497 I389M possibly damaging Het
Axdnd1 A G 1: 156,397,453 V47A Het
Cachd1 T A 4: 100,967,047 L562M probably benign Het
Cadm2 A T 16: 66,731,471 I326N probably benign Het
Ccpg1 T C 9: 73,015,505 F799S probably damaging Het
Ces1c T C 8: 93,106,603 I411M probably benign Het
Cgn T G 3: 94,762,634 K1066N probably damaging Het
Cntn4 A G 6: 106,353,723 I101V probably benign Het
Cntrl A G 2: 35,170,580 E1928G probably benign Het
Cxcl12 A G 6: 117,171,503 Y28C probably damaging Het
Cyp2r1 A T 7: 114,554,589 probably null Het
D430041D05Rik C T 2: 104,257,629 W334* probably null Het
Dsp G A 13: 38,184,018 R671Q possibly damaging Het
Fancm A G 12: 65,126,794 K1960R probably benign Het
Fgd5 T A 6: 92,068,478 Y1331N probably damaging Het
Ina G A 19: 47,015,661 E303K Het
Kctd3 C A 1: 188,983,046 V369F possibly damaging Het
Kif14 T C 1: 136,471,576 probably null Het
Kif14 T C 1: 136,516,025 V1312A probably benign Het
Krt84 T C 15: 101,528,391 I403V probably benign Het
Krtap9-1 A C 11: 99,873,530 T31P unknown Het
Lyrm9 A T 11: 78,838,141 I60F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mmp28 T C 11: 83,443,926 D334G probably damaging Het
Nr1h5 T C 3: 102,949,615 T194A possibly damaging Het
Nrf1 A G 6: 30,090,300 I85M probably benign Het
Nrp2 C T 1: 62,783,521 R758C probably damaging Het
Olfr1471 A T 19: 13,445,587 T192S probably benign Het
Pcdhga4 A G 18: 37,686,628 D410G probably damaging Het
Pld1 T C 3: 28,045,009 V275A probably damaging Het
Plxnc1 A T 10: 94,843,836 F895I probably benign Het
Polr2a A G 11: 69,736,174 I1486T possibly damaging Het
Ptprz1 A G 6: 23,002,257 M1449V probably benign Het
Rspo4 C A 2: 151,869,826 T156N probably damaging Het
Sacs A G 14: 61,207,071 I2189V probably benign Het
Stat5b A C 11: 100,783,775 F711V possibly damaging Het
Stk11ip C A 1: 75,529,464 Q543K probably benign Het
Tarbp1 G A 8: 126,456,493 T529M probably damaging Het
Tmem19 A G 10: 115,343,703 F296S probably benign Het
Tnfsf13b A G 8: 10,007,078 N79S not run Het
Vdac3 C A 8: 22,579,057 G214C probably damaging Het
Vmn2r18 A C 5: 151,561,864 F722V probably damaging Het
Vmn2r45 A G 7: 8,483,410 L293S possibly damaging Het
Vmn2r88 C G 14: 51,413,046 A72G probably benign Het
Xpot A G 10: 121,619,091 probably null Het
Zfp526 G A 7: 25,221,435 probably benign Het
Zfp532 A G 18: 65,623,490 T165A probably benign Het
Other mutations in Thada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Thada APN 17 84444218 missense probably benign 0.01
IGL00902:Thada APN 17 84447976 missense probably damaging 1.00
IGL01634:Thada APN 17 84393358 critical splice donor site probably null
IGL01689:Thada APN 17 84446688 missense possibly damaging 0.80
IGL01693:Thada APN 17 84446644 missense probably benign
IGL01937:Thada APN 17 84222766 missense probably benign 0.00
IGL01945:Thada APN 17 84222766 missense probably benign 0.00
IGL02231:Thada APN 17 84428697 missense probably damaging 1.00
IGL02951:Thada APN 17 84444028 missense probably benign 0.16
IGL03167:Thada APN 17 84458849 missense probably damaging 0.97
IGL03279:Thada APN 17 84435560 missense probably benign 0.01
IGL03347:Thada APN 17 84398205 missense probably damaging 1.00
H8562:Thada UTSW 17 84446544 missense probably damaging 1.00
IGL03098:Thada UTSW 17 84334141 missense possibly damaging 0.93
R0006:Thada UTSW 17 84226040 missense probably benign 0.00
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0357:Thada UTSW 17 84230936 missense probably damaging 1.00
R0388:Thada UTSW 17 84231096 missense probably benign 0.00
R0543:Thada UTSW 17 84423163 missense probably damaging 1.00
R0606:Thada UTSW 17 84416303 missense possibly damaging 0.90
R0630:Thada UTSW 17 84229175 missense probably damaging 1.00
R0664:Thada UTSW 17 84336829 missense probably damaging 1.00
R0855:Thada UTSW 17 84436655 missense probably damaging 1.00
R0972:Thada UTSW 17 84429062 splice site probably benign
R1297:Thada UTSW 17 84252435 splice site probably benign
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1490:Thada UTSW 17 84446601 missense possibly damaging 0.68
R1789:Thada UTSW 17 84448033 missense probably damaging 1.00
R1789:Thada UTSW 17 84448034 missense probably damaging 1.00
R1802:Thada UTSW 17 84464407 missense probably benign 0.34
R1831:Thada UTSW 17 84231114 missense probably damaging 0.97
R1834:Thada UTSW 17 84226004 missense possibly damaging 0.53
R1881:Thada UTSW 17 84436702 missense probably benign 0.19
R1925:Thada UTSW 17 84444499 missense probably benign 0.05
R1969:Thada UTSW 17 84310042 missense probably damaging 1.00
R1970:Thada UTSW 17 84310042 missense probably damaging 1.00
R1971:Thada UTSW 17 84310042 missense probably damaging 1.00
R2149:Thada UTSW 17 84441764 missense probably damaging 1.00
R2191:Thada UTSW 17 84446521 missense probably benign 0.00
R2571:Thada UTSW 17 84454640 missense probably damaging 0.99
R3405:Thada UTSW 17 84230785 splice site probably benign
R3406:Thada UTSW 17 84230785 splice site probably benign
R3916:Thada UTSW 17 84441782 missense possibly damaging 0.92
R4044:Thada UTSW 17 84441707 missense probably benign 0.41
R4461:Thada UTSW 17 84426237 missense probably damaging 1.00
R4662:Thada UTSW 17 84435650 missense probably damaging 1.00
R4696:Thada UTSW 17 84426186 missense possibly damaging 0.83
R4786:Thada UTSW 17 84458855 missense possibly damaging 0.66
R4803:Thada UTSW 17 84272817 missense probably damaging 0.96
R4835:Thada UTSW 17 84441104 splice site probably null
R4872:Thada UTSW 17 84446599 missense probably damaging 1.00
R4898:Thada UTSW 17 84448042 splice site probably null
R4903:Thada UTSW 17 84252400 missense possibly damaging 0.67
R4929:Thada UTSW 17 84444226 missense probably benign 0.01
R4959:Thada UTSW 17 84444183 missense probably damaging 1.00
R5071:Thada UTSW 17 84386532 missense probably damaging 1.00
R5092:Thada UTSW 17 84444468 missense probably damaging 0.97
R5398:Thada UTSW 17 84426186 missense probably benign 0.03
R5480:Thada UTSW 17 84432254 missense probably benign 0.00
R5552:Thada UTSW 17 84429130 missense probably benign 0.03
R5575:Thada UTSW 17 84416399 splice site probably null
R5623:Thada UTSW 17 84191983 missense probably benign 0.00
R5688:Thada UTSW 17 84451727 missense probably benign 0.00
R5704:Thada UTSW 17 84230901 missense probably benign 0.01
R6008:Thada UTSW 17 84436634 missense probably damaging 1.00
R6013:Thada UTSW 17 84272800 missense probably benign 0.00
R6072:Thada UTSW 17 84192006 missense possibly damaging 0.93
R6156:Thada UTSW 17 84393367 missense probably damaging 0.98
R6243:Thada UTSW 17 84436602 missense probably benign 0.01
R6449:Thada UTSW 17 84429173 missense probably benign
R6453:Thada UTSW 17 84416323 missense probably damaging 1.00
R6474:Thada UTSW 17 84443911 missense possibly damaging 0.83
R6732:Thada UTSW 17 84454414 intron probably null
R6907:Thada UTSW 17 84393469 missense probably damaging 1.00
R7117:Thada UTSW 17 84230786 splice site probably null
R7167:Thada UTSW 17 84230963 missense probably benign
R7221:Thada UTSW 17 84464366 missense possibly damaging 0.46
R7470:Thada UTSW 17 84226041 missense probably benign
R7753:Thada UTSW 17 84252390 missense probably damaging 1.00
R7809:Thada UTSW 17 84451837 missense possibly damaging 0.80
R7965:Thada UTSW 17 84429196 missense possibly damaging 0.85
R8004:Thada UTSW 17 84192205 missense probably benign
R8153:Thada UTSW 17 84393427 missense possibly damaging 0.90
Z1176:Thada UTSW 17 84444430 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTTTTCCCAAGACACACTCCAGTG -3'
(R):5'- AAGTTGGTAACGGGCTGATACC -3'

Sequencing Primer
(F):5'- CTCCAGTGAGAAGCTAAAGGTAG -3'
(R):5'- TGACCTGAGTTGGAATCACC -3'
Posted On2019-12-20