Incidental Mutation 'R7883:Sis'
ID608865
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Namesucrase isomaltase (alpha-glucosidase)
SynonymsSi-s, sucrase-isomaltase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7883 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location72888557-72967863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72920996 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1220 (C1220S)
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094190
AA Change: C1220S

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: C1220S

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167334
AA Change: C1220S

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: C1220S

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Meta Mutation Damage Score 0.2033 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik A T 4: 124,850,647 W5R unknown Het
4430402I18Rik A C 19: 28,928,613 S297A probably benign Het
Abcb6 A T 1: 75,178,016 S258R possibly damaging Het
Abcc10 A G 17: 46,307,101 V1082A probably benign Het
Adrb2 A G 18: 62,179,376 V126A probably damaging Het
Apol11a A G 15: 77,516,574 E87G probably damaging Het
Arhgap45 T A 10: 80,027,589 C755* probably null Het
Arl13b A T 16: 62,827,266 I93K probably damaging Het
Aspm A G 1: 139,478,667 K1764R possibly damaging Het
Atp8b5 A G 4: 43,342,471 I381V probably damaging Het
Atxn2 A G 5: 121,802,117 H985R possibly damaging Het
Bms1 G T 6: 118,388,774 N1150K probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camta2 T C 11: 70,675,211 D749G probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cep152 G A 2: 125,613,058 A274V possibly damaging Het
Chd7 A G 4: 8,826,504 N956S probably damaging Het
Cpt1c A T 7: 44,964,014 probably null Het
Cttn C T 7: 144,445,818 V338I probably benign Het
Dab2ip G A 2: 35,720,206 G811D possibly damaging Het
Dmtf1 T C 5: 9,140,397 T106A probably benign Het
Dync2h1 T C 9: 7,005,566 E3768G possibly damaging Het
Exoc1 T A 5: 76,561,382 D612E probably damaging Het
Fat2 T C 11: 55,253,364 probably null Het
Fat4 G A 3: 38,981,819 E3207K probably damaging Het
Fbxw18 A G 9: 109,688,406 Y410H probably damaging Het
Fgfr3 T A 5: 33,733,891 S518T probably damaging Het
Fzr1 G A 10: 81,368,635 T377M probably damaging Het
Gcnt3 T A 9: 70,034,171 I372F probably damaging Het
Gm10577 A T 4: 101,020,522 Y59N unknown Het
Gm826 A G 2: 160,327,293 L32P unknown Het
Grid1 T G 14: 35,450,302 probably null Het
Hid1 T A 11: 115,354,609 T457S probably damaging Het
Hsd3b5 A G 3: 98,622,140 V58A probably benign Het
Iqcj A G 3: 68,047,308 K49E probably damaging Het
Itpk1 A G 12: 102,606,175 V93A probably benign Het
Kcnt2 A G 1: 140,523,150 I722M probably damaging Het
Klhl36 T C 8: 119,874,478 V412A possibly damaging Het
Krt18 G A 15: 102,028,450 V58M possibly damaging Het
Lats2 T C 14: 57,697,200 Y691C probably damaging Het
Lrp1b A T 2: 40,665,129 I4095N Het
Map1a A G 2: 121,305,372 E2223G probably damaging Het
Med25 A G 7: 44,891,808 F94L possibly damaging Het
Mertk A G 2: 128,776,345 I499V probably benign Het
Mrps12 A G 7: 28,740,143 L49P probably benign Het
Nwd1 T A 8: 72,667,126 V339D probably damaging Het
Obscn G A 11: 59,070,009 Q3159* probably null Het
Patj G A 4: 98,611,135 V1349I probably benign Het
Pcdha8 T A 18: 36,993,143 V226D probably damaging Het
Pdgfd T A 9: 6,293,939 probably null Het
Pdzd7 A C 19: 45,030,240 I600S probably damaging Het
Pgpep1l G A 7: 68,239,149 R45* probably null Het
Pik3c3 T C 18: 30,274,363 S55P probably benign Het
Pkhd1l1 A T 15: 44,529,126 D1619V probably damaging Het
Pkp1 A G 1: 135,884,903 probably null Het
Ppan T A 9: 20,891,481 I311N probably benign Het
Ppih C A 4: 119,310,790 G175W probably damaging Het
Ppp1r8 G T 4: 132,834,715 Q65K probably damaging Het
Psmd5 T A 2: 34,856,512 K351M possibly damaging Het
Pth1r T C 9: 110,731,558 K53R probably benign Het
Ptprn A T 1: 75,262,363 F9L probably damaging Het
Rgl3 T C 9: 21,981,427 I288V probably benign Het
Sds A G 5: 120,479,213 I45V possibly damaging Het
Sfxn4 A T 19: 60,858,749 probably null Het
Slc22a16 T G 10: 40,603,664 D577E probably benign Het
Slc25a10 T A 11: 120,494,514 M43K possibly damaging Het
Smpd1 T C 7: 105,556,985 I440T probably damaging Het
St6galnac6 A G 2: 32,614,929 N151S probably benign Het
Taf4 G T 2: 179,929,295 L742M probably damaging Het
Tctn1 A G 5: 122,264,312 S20P possibly damaging Het
Tkfc A T 19: 10,595,030 probably null Het
Tmem270 A G 5: 134,902,827 V87A possibly damaging Het
Tpo T C 12: 30,103,170 H395R probably damaging Het
Tufm T C 7: 126,488,942 F206L possibly damaging Het
Tulp2 A G 7: 45,516,764 probably null Het
Tulp3 G A 6: 128,326,844 T264M probably damaging Het
Uqcrc2 A G 7: 120,645,217 D194G possibly damaging Het
Vill C A 9: 119,065,521 C415* probably null Het
Zfp799 A G 17: 32,820,282 C337R probably damaging Het
Zhx2 A G 15: 57,821,874 E213G possibly damaging Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72946636 missense probably benign
IGL00715:Sis APN 3 72934124 missense probably damaging 1.00
IGL00721:Sis APN 3 72943579 missense probably damaging 1.00
IGL00766:Sis APN 3 72907237 splice site probably benign
IGL00783:Sis APN 3 72946632 missense probably benign
IGL00805:Sis APN 3 72934199 missense probably benign 0.05
IGL00932:Sis APN 3 72940956 splice site probably benign
IGL01020:Sis APN 3 72966838 missense probably damaging 1.00
IGL01024:Sis APN 3 72911876 missense probably damaging 1.00
IGL01286:Sis APN 3 72941025 missense probably damaging 1.00
IGL01457:Sis APN 3 72961021 missense probably benign
IGL01514:Sis APN 3 72935920 splice site probably benign
IGL01986:Sis APN 3 72945212 missense probably damaging 1.00
IGL02110:Sis APN 3 72928699 nonsense probably null
IGL02132:Sis APN 3 72947471 missense probably benign 0.00
IGL02152:Sis APN 3 72888986 utr 3 prime probably benign
IGL02200:Sis APN 3 72943604 missense probably damaging 0.99
IGL02244:Sis APN 3 72956190 missense probably benign 0.19
IGL02307:Sis APN 3 72911834 splice site probably benign
IGL02374:Sis APN 3 72925456 missense probably benign 0.03
IGL02437:Sis APN 3 72919614 critical splice acceptor site probably null
IGL02571:Sis APN 3 72956304 splice site probably benign
IGL02601:Sis APN 3 72913210 missense probably benign 0.44
IGL03063:Sis APN 3 72928297 missense probably benign
IGL03382:Sis APN 3 72928719 missense probably benign 0.00
IGL03397:Sis APN 3 72935879 missense probably benign 0.44
PIT1430001:Sis UTSW 3 72922829 missense probably damaging 0.97
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0046:Sis UTSW 3 72932094 missense probably benign 0.01
R0094:Sis UTSW 3 72921437 missense probably damaging 1.00
R0096:Sis UTSW 3 72928267 missense probably damaging 1.00
R0505:Sis UTSW 3 72960296 missense probably benign 0.29
R0544:Sis UTSW 3 72951642 missense probably damaging 1.00
R0551:Sis UTSW 3 72925407 missense possibly damaging 0.79
R0617:Sis UTSW 3 72965605 missense probably damaging 1.00
R0698:Sis UTSW 3 72910498 missense probably damaging 1.00
R0701:Sis UTSW 3 72941045 missense probably damaging 1.00
R0704:Sis UTSW 3 72949822 missense possibly damaging 0.63
R0706:Sis UTSW 3 72952531 missense probably damaging 1.00
R0710:Sis UTSW 3 72952531 missense probably damaging 1.00
R0752:Sis UTSW 3 72952531 missense probably damaging 1.00
R0753:Sis UTSW 3 72952531 missense probably damaging 1.00
R0754:Sis UTSW 3 72952531 missense probably damaging 1.00
R0767:Sis UTSW 3 72952531 missense probably damaging 1.00
R0769:Sis UTSW 3 72952531 missense probably damaging 1.00
R0772:Sis UTSW 3 72952531 missense probably damaging 1.00
R0774:Sis UTSW 3 72952531 missense probably damaging 1.00
R0776:Sis UTSW 3 72952531 missense probably damaging 1.00
R0818:Sis UTSW 3 72952531 missense probably damaging 1.00
R0819:Sis UTSW 3 72952531 missense probably damaging 1.00
R0885:Sis UTSW 3 72911949 nonsense probably null
R1076:Sis UTSW 3 72934098 missense probably damaging 0.97
R1140:Sis UTSW 3 72951616 missense probably damaging 0.98
R1175:Sis UTSW 3 72958104 splice site probably benign
R1301:Sis UTSW 3 72946582 missense possibly damaging 0.76
R1437:Sis UTSW 3 72934142 missense probably damaging 1.00
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1472:Sis UTSW 3 72889027 missense probably benign 0.12
R1584:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1707:Sis UTSW 3 72909087 splice site probably benign
R1715:Sis UTSW 3 72889010 missense possibly damaging 0.47
R1719:Sis UTSW 3 72965604 missense probably damaging 1.00
R1728:Sis UTSW 3 72965645 nonsense probably null
R1784:Sis UTSW 3 72965645 nonsense probably null
R1820:Sis UTSW 3 72921142 missense probably damaging 1.00
R1972:Sis UTSW 3 72921004 missense probably damaging 1.00
R1973:Sis UTSW 3 72921004 missense probably damaging 1.00
R2054:Sis UTSW 3 72913237 missense probably benign 0.01
R2233:Sis UTSW 3 72913194 missense probably benign 0.03
R2235:Sis UTSW 3 72913194 missense probably benign 0.03
R2276:Sis UTSW 3 72914601 nonsense probably null
R2435:Sis UTSW 3 72911904 missense probably benign 0.01
R2885:Sis UTSW 3 72909173 missense probably benign 0.01
R2966:Sis UTSW 3 72889010 missense probably benign 0.30
R3708:Sis UTSW 3 72943523 missense probably benign 0.02
R3790:Sis UTSW 3 72921414 missense probably damaging 1.00
R3807:Sis UTSW 3 72925596 missense probably benign 0.01
R3858:Sis UTSW 3 72928652 missense probably damaging 0.99
R3974:Sis UTSW 3 72943635 missense probably damaging 0.96
R3975:Sis UTSW 3 72943635 missense probably damaging 0.96
R4037:Sis UTSW 3 72928602 missense probably benign
R4080:Sis UTSW 3 72921184 missense probably damaging 1.00
R4204:Sis UTSW 3 72961082 missense probably benign
R4394:Sis UTSW 3 72956149 missense probably damaging 1.00
R4470:Sis UTSW 3 72928159 splice site probably null
R4573:Sis UTSW 3 72928237 missense possibly damaging 0.94
R4868:Sis UTSW 3 72943548 missense probably benign 0.09
R5023:Sis UTSW 3 72934122 missense probably benign 0.05
R5264:Sis UTSW 3 72949756 missense probably damaging 0.98
R5414:Sis UTSW 3 72952493 missense probably benign
R5462:Sis UTSW 3 72949838 missense probably damaging 0.96
R5523:Sis UTSW 3 72891421 missense probably benign 0.00
R5584:Sis UTSW 3 72910415 missense probably damaging 1.00
R5587:Sis UTSW 3 72914576 missense possibly damaging 0.94
R5725:Sis UTSW 3 72965598 missense probably damaging 1.00
R5769:Sis UTSW 3 72928235 missense probably damaging 0.98
R5790:Sis UTSW 3 72928174 missense probably benign
R5864:Sis UTSW 3 72949818 missense probably damaging 1.00
R5902:Sis UTSW 3 72960256 critical splice donor site probably null
R5925:Sis UTSW 3 72921380 splice site probably null
R6018:Sis UTSW 3 72913192 missense possibly damaging 0.95
R6029:Sis UTSW 3 72928308 missense probably benign 0.30
R6124:Sis UTSW 3 72953211 missense possibly damaging 0.69
R6171:Sis UTSW 3 72961027 missense possibly damaging 0.75
R6182:Sis UTSW 3 72904293 missense probably benign 0.05
R6295:Sis UTSW 3 72966770 missense probably damaging 0.99
R6416:Sis UTSW 3 72911854 missense probably damaging 1.00
R6431:Sis UTSW 3 72958174 missense probably benign 0.00
R6472:Sis UTSW 3 72938734 nonsense probably null
R6517:Sis UTSW 3 72907142 missense probably damaging 1.00
R6701:Sis UTSW 3 72949527 missense probably damaging 1.00
R6796:Sis UTSW 3 72965618 missense probably benign 0.06
R6853:Sis UTSW 3 72891426 missense possibly damaging 0.93
R6906:Sis UTSW 3 72919485 missense probably damaging 1.00
R7058:Sis UTSW 3 72903607 missense probably damaging 0.98
R7357:Sis UTSW 3 72925071 missense probably damaging 1.00
R7381:Sis UTSW 3 72913292 splice site probably null
R7439:Sis UTSW 3 72909041 missense possibly damaging 0.81
R7742:Sis UTSW 3 72925098 missense probably benign 0.19
R7813:Sis UTSW 3 72925468 missense probably benign 0.01
R7899:Sis UTSW 3 72937251 missense probably damaging 1.00
R7915:Sis UTSW 3 72921138 missense probably damaging 0.99
R8020:Sis UTSW 3 72908965 critical splice donor site probably null
R8023:Sis UTSW 3 72952480 missense probably damaging 0.97
R8029:Sis UTSW 3 72921142 missense probably damaging 1.00
R8053:Sis UTSW 3 72949568 nonsense probably null
R8062:Sis UTSW 3 72920988 nonsense probably null
R8074:Sis UTSW 3 72917198 missense probably damaging 1.00
R8085:Sis UTSW 3 72907129 missense probably damaging 1.00
R8137:Sis UTSW 3 72889045 missense probably benign 0.22
R8349:Sis UTSW 3 72903651 missense probably damaging 1.00
R8354:Sis UTSW 3 72947501 missense possibly damaging 0.84
R8366:Sis UTSW 3 72958233 missense probably damaging 1.00
R8449:Sis UTSW 3 72903651 missense probably damaging 1.00
R8454:Sis UTSW 3 72947501 missense possibly damaging 0.84
R8515:Sis UTSW 3 72929409 missense probably benign 0.00
X0009:Sis UTSW 3 72889022 missense probably damaging 0.99
X0024:Sis UTSW 3 72928670 missense probably benign
X0060:Sis UTSW 3 72920906 intron probably benign
Z1176:Sis UTSW 3 72904273 missense probably benign 0.05
Z1176:Sis UTSW 3 72943557 missense probably benign 0.25
Z1177:Sis UTSW 3 72909172 missense possibly damaging 0.88
Z1177:Sis UTSW 3 72910474 missense probably damaging 1.00
Z1177:Sis UTSW 3 72943569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTCCCAAAGATGCTACTG -3'
(R):5'- TGCTCTAACCTACCGCACAATTG -3'

Sequencing Primer
(F):5'- GTCCCAAAGATGCTACTGAAATATG -3'
(R):5'- TTACATGTTTTTGGGACCAACC -3'
Posted On2019-12-20