Incidental Mutation 'R7883:Patj'
ID608869
Institutional Source Beutler Lab
Gene Symbol Patj
Ensembl Gene ENSMUSG00000061859
Gene NamePATJ, crumbs cell polarity complex component
SynonymsInadl, Cipp
Accession Numbers

Genbank: NM_172696; MGI: 1277960

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7883 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location98395785-98719603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98611135 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1349 (V1349I)
Ref Sequence ENSEMBL: ENSMUSP00000049176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030290] [ENSMUST00000041284] [ENSMUST00000102792] [ENSMUST00000107029] [ENSMUST00000107034]
Predicted Effect probably benign
Transcript: ENSMUST00000030290
AA Change: V127I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030290
Gene: ENSMUSG00000061859
AA Change: V127I

DomainStartEndE-ValueType
PDZ 31 106 6.12e-19 SMART
low complexity region 134 144 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
PDZ 258 333 4.36e-24 SMART
PDZ 355 428 2.49e-19 SMART
PDZ 496 573 1.73e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041284
AA Change: V1349I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859
AA Change: V1349I

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 570 641 1.28e-12 SMART
PDZ 696 775 9.5e-16 SMART
low complexity region 980 991 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
PDZ 1083 1166 8.65e-19 SMART
PDZ 1253 1328 6.12e-19 SMART
low complexity region 1356 1366 N/A INTRINSIC
low complexity region 1410 1428 N/A INTRINSIC
PDZ 1480 1555 4.36e-24 SMART
PDZ 1577 1650 2.49e-19 SMART
PDZ 1718 1795 2.13e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102792
AA Change: V127I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099854
Gene: ENSMUSG00000061859
AA Change: V127I

DomainStartEndE-ValueType
PDZ 31 106 6.12e-19 SMART
low complexity region 134 144 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
PDZ 258 333 4.36e-24 SMART
PDZ 355 428 2.49e-19 SMART
PDZ 496 573 2.13e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107029
AA Change: V776I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102644
Gene: ENSMUSG00000061859
AA Change: V776I

DomainStartEndE-ValueType
PDZ 1 68 1e-9 SMART
PDZ 123 202 4.7e-18 SMART
low complexity region 407 418 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
PDZ 510 593 4.3e-21 SMART
PDZ 680 755 2.9e-21 SMART
low complexity region 783 793 N/A INTRINSIC
low complexity region 837 855 N/A INTRINSIC
PDZ 907 982 2.2e-26 SMART
PDZ 1004 1077 1.2e-21 SMART
PDZ 1145 1222 1e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107034
AA Change: V1345I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102649
Gene: ENSMUSG00000061859
AA Change: V1345I

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 566 637 1.28e-12 SMART
PDZ 692 771 9.5e-16 SMART
low complexity region 976 987 N/A INTRINSIC
low complexity region 1050 1058 N/A INTRINSIC
PDZ 1079 1162 8.65e-19 SMART
PDZ 1249 1324 6.12e-19 SMART
low complexity region 1352 1362 N/A INTRINSIC
low complexity region 1382 1400 N/A INTRINSIC
PDZ 1452 1499 7.78e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik A T 4: 124,850,647 W5R unknown Het
4430402I18Rik A C 19: 28,928,613 S297A probably benign Het
Abcb6 A T 1: 75,178,016 S258R possibly damaging Het
Abcc10 A G 17: 46,307,101 V1082A probably benign Het
Adrb2 A G 18: 62,179,376 V126A probably damaging Het
Apol11a A G 15: 77,516,574 E87G probably damaging Het
Arhgap45 T A 10: 80,027,589 C755* probably null Het
Arl13b A T 16: 62,827,266 I93K probably damaging Het
Aspm A G 1: 139,478,667 K1764R possibly damaging Het
Atp8b5 A G 4: 43,342,471 I381V probably damaging Het
Atxn2 A G 5: 121,802,117 H985R possibly damaging Het
Bms1 G T 6: 118,388,774 N1150K probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camta2 T C 11: 70,675,211 D749G probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cep152 G A 2: 125,613,058 A274V possibly damaging Het
Chd7 A G 4: 8,826,504 N956S probably damaging Het
Cpt1c A T 7: 44,964,014 probably null Het
Cttn C T 7: 144,445,818 V338I probably benign Het
Dab2ip G A 2: 35,720,206 G811D possibly damaging Het
Dmtf1 T C 5: 9,140,397 T106A probably benign Het
Dync2h1 T C 9: 7,005,566 E3768G possibly damaging Het
Exoc1 T A 5: 76,561,382 D612E probably damaging Het
Fat2 T C 11: 55,253,364 probably null Het
Fat4 G A 3: 38,981,819 E3207K probably damaging Het
Fbxw18 A G 9: 109,688,406 Y410H probably damaging Het
Fgfr3 T A 5: 33,733,891 S518T probably damaging Het
Fzr1 G A 10: 81,368,635 T377M probably damaging Het
Gcnt3 T A 9: 70,034,171 I372F probably damaging Het
Gm10577 A T 4: 101,020,522 Y59N unknown Het
Gm826 A G 2: 160,327,293 L32P unknown Het
Grid1 T G 14: 35,450,302 probably null Het
Hid1 T A 11: 115,354,609 T457S probably damaging Het
Hsd3b5 A G 3: 98,622,140 V58A probably benign Het
Iqcj A G 3: 68,047,308 K49E probably damaging Het
Itpk1 A G 12: 102,606,175 V93A probably benign Het
Kcnt2 A G 1: 140,523,150 I722M probably damaging Het
Klhl36 T C 8: 119,874,478 V412A possibly damaging Het
Krt18 G A 15: 102,028,450 V58M possibly damaging Het
Lats2 T C 14: 57,697,200 Y691C probably damaging Het
Lrp1b A T 2: 40,665,129 I4095N Het
Map1a A G 2: 121,305,372 E2223G probably damaging Het
Med25 A G 7: 44,891,808 F94L possibly damaging Het
Mertk A G 2: 128,776,345 I499V probably benign Het
Mrps12 A G 7: 28,740,143 L49P probably benign Het
Nwd1 T A 8: 72,667,126 V339D probably damaging Het
Obscn G A 11: 59,070,009 Q3159* probably null Het
Pcdha8 T A 18: 36,993,143 V226D probably damaging Het
Pdgfd T A 9: 6,293,939 probably null Het
Pdzd7 A C 19: 45,030,240 I600S probably damaging Het
Pgpep1l G A 7: 68,239,149 R45* probably null Het
Pik3c3 T C 18: 30,274,363 S55P probably benign Het
Pkhd1l1 A T 15: 44,529,126 D1619V probably damaging Het
Pkp1 A G 1: 135,884,903 probably null Het
Ppan T A 9: 20,891,481 I311N probably benign Het
Ppih C A 4: 119,310,790 G175W probably damaging Het
Ppp1r8 G T 4: 132,834,715 Q65K probably damaging Het
Psmd5 T A 2: 34,856,512 K351M possibly damaging Het
Pth1r T C 9: 110,731,558 K53R probably benign Het
Ptprn A T 1: 75,262,363 F9L probably damaging Het
Rgl3 T C 9: 21,981,427 I288V probably benign Het
Sds A G 5: 120,479,213 I45V possibly damaging Het
Sfxn4 A T 19: 60,858,749 probably null Het
Sis A T 3: 72,920,996 C1220S possibly damaging Het
Slc22a16 T G 10: 40,603,664 D577E probably benign Het
Slc25a10 T A 11: 120,494,514 M43K possibly damaging Het
Smpd1 T C 7: 105,556,985 I440T probably damaging Het
St6galnac6 A G 2: 32,614,929 N151S probably benign Het
Taf4 G T 2: 179,929,295 L742M probably damaging Het
Tctn1 A G 5: 122,264,312 S20P possibly damaging Het
Tkfc A T 19: 10,595,030 probably null Het
Tmem270 A G 5: 134,902,827 V87A possibly damaging Het
Tpo T C 12: 30,103,170 H395R probably damaging Het
Tufm T C 7: 126,488,942 F206L possibly damaging Het
Tulp2 A G 7: 45,516,764 probably null Het
Tulp3 G A 6: 128,326,844 T264M probably damaging Het
Uqcrc2 A G 7: 120,645,217 D194G possibly damaging Het
Vill C A 9: 119,065,521 C415* probably null Het
Zfp799 A G 17: 32,820,282 C337R probably damaging Het
Zhx2 A G 15: 57,821,874 E213G possibly damaging Het
Other mutations in Patj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Patj APN 4 98465106 missense probably damaging 1.00
IGL00095:Patj APN 4 98535562 missense possibly damaging 0.78
IGL00517:Patj APN 4 98441071 missense possibly damaging 0.95
IGL00802:Patj APN 4 98424406 missense possibly damaging 0.93
IGL01064:Patj APN 4 98496973 missense possibly damaging 0.95
IGL01110:Patj APN 4 98413024 missense probably damaging 0.99
IGL01407:Patj APN 4 98413050 missense possibly damaging 0.49
IGL01821:Patj APN 4 98456211 missense probably damaging 1.00
IGL02399:Patj APN 4 98591936 missense probably damaging 1.00
IGL02494:Patj APN 4 98703987 splice site probably benign
IGL02803:Patj APN 4 98426064 missense probably damaging 0.99
IGL02931:Patj APN 4 98411173 splice site probably benign
IGL03017:Patj APN 4 98465027 splice site probably benign
IGL03115:Patj APN 4 98443803 missense probably damaging 1.00
IGL03209:Patj APN 4 98465140 missense probably null 1.00
IGL03377:Patj APN 4 98465104 missense probably damaging 1.00
D4186:Patj UTSW 4 98638762 missense probably benign 0.17
PIT4531001:Patj UTSW 4 98441090 missense probably damaging 0.98
R0136:Patj UTSW 4 98667648 missense probably damaging 1.00
R0294:Patj UTSW 4 98497048 missense probably damaging 0.99
R0376:Patj UTSW 4 98568987 missense probably damaging 1.00
R0463:Patj UTSW 4 98674308 missense probably damaging 1.00
R0465:Patj UTSW 4 98535507 splice site probably null
R0466:Patj UTSW 4 98688156 missense probably damaging 1.00
R0544:Patj UTSW 4 98569110 missense probably damaging 1.00
R0624:Patj UTSW 4 98681235 splice site probably benign
R0657:Patj UTSW 4 98667648 missense probably damaging 1.00
R1281:Patj UTSW 4 98416695 missense probably damaging 1.00
R1393:Patj UTSW 4 98424411 missense probably benign 0.01
R1480:Patj UTSW 4 98469582 missense probably damaging 1.00
R1667:Patj UTSW 4 98413027 missense probably damaging 1.00
R1728:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1729:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1797:Patj UTSW 4 98687438 missense probably damaging 1.00
R1818:Patj UTSW 4 98623648 missense possibly damaging 0.85
R1835:Patj UTSW 4 98491590 missense probably benign 0.00
R1880:Patj UTSW 4 98497240 missense probably benign 0.00
R2009:Patj UTSW 4 98456169 missense probably damaging 1.00
R2090:Patj UTSW 4 98437323 unclassified probably benign
R2120:Patj UTSW 4 98456225 missense probably benign 0.01
R2180:Patj UTSW 4 98523502 critical splice donor site probably null
R2655:Patj UTSW 4 98437450 missense possibly damaging 0.64
R3156:Patj UTSW 4 98674228 missense probably damaging 1.00
R3749:Patj UTSW 4 98469600 missense probably damaging 1.00
R3767:Patj UTSW 4 98681219 nonsense probably null
R3913:Patj UTSW 4 98569101 missense probably damaging 0.99
R3917:Patj UTSW 4 98592008 nonsense probably null
R3918:Patj UTSW 4 98456218 missense probably damaging 1.00
R4299:Patj UTSW 4 98677321 missense possibly damaging 0.89
R4355:Patj UTSW 4 98650454 missense possibly damaging 0.87
R4471:Patj UTSW 4 98535579 missense probably damaging 1.00
R4762:Patj UTSW 4 98405570 nonsense probably null
R4877:Patj UTSW 4 98569058 missense possibly damaging 0.94
R4945:Patj UTSW 4 98495064 missense probably damaging 0.97
R5274:Patj UTSW 4 98518981 missense probably damaging 0.99
R5343:Patj UTSW 4 98676193 missense probably damaging 1.00
R5554:Patj UTSW 4 98454396 missense possibly damaging 0.79
R5688:Patj UTSW 4 98520810 nonsense probably null
R5880:Patj UTSW 4 98411145 missense probably damaging 0.96
R5972:Patj UTSW 4 98569053 missense probably damaging 0.98
R6149:Patj UTSW 4 98424325 missense possibly damaging 0.72
R6192:Patj UTSW 4 98456157 missense probably damaging 1.00
R6265:Patj UTSW 4 98469567 missense probably benign 0.08
R6350:Patj UTSW 4 98405618 missense probably benign 0.26
R6363:Patj UTSW 4 98431860 missense probably benign 0.25
R6434:Patj UTSW 4 98491629 missense probably damaging 1.00
R6496:Patj UTSW 4 98416752 missense probably damaging 1.00
R6896:Patj UTSW 4 98426050 missense possibly damaging 0.87
R7039:Patj UTSW 4 98569078 missense probably damaging 0.96
R7040:Patj UTSW 4 98441080 missense probably benign 0.02
R7052:Patj UTSW 4 98677260 missense probably benign 0.03
R7066:Patj UTSW 4 98413197 missense probably benign 0.24
R7236:Patj UTSW 4 98411057 missense probably damaging 1.00
R7242:Patj UTSW 4 98591933 missense probably benign 0.26
R7260:Patj UTSW 4 98416733 missense possibly damaging 0.94
R7412:Patj UTSW 4 98411139 missense probably damaging 0.98
R7493:Patj UTSW 4 98495061 missense probably benign 0.41
R7570:Patj UTSW 4 98424500 splice site probably null
R7571:Patj UTSW 4 98568980 missense probably damaging 1.00
R7626:Patj UTSW 4 98546987 missense probably benign 0.35
R7658:Patj UTSW 4 98688179 missense probably damaging 1.00
R7664:Patj UTSW 4 98496950 missense possibly damaging 0.92
R7669:Patj UTSW 4 98518942 missense probably damaging 1.00
R7796:Patj UTSW 4 98546983 start codon destroyed probably benign 0.05
R7870:Patj UTSW 4 98424316 missense probably damaging 1.00
R7948:Patj UTSW 4 98424310 missense probably damaging 0.99
R7953:Patj UTSW 4 98424316 missense probably damaging 1.00
R7966:Patj UTSW 4 98611135 missense probably benign 0.00
R8050:Patj UTSW 4 98538964 missense probably benign 0.00
Z1176:Patj UTSW 4 98611130 missense probably benign 0.11
Z1176:Patj UTSW 4 98676318 nonsense probably null
Z1177:Patj UTSW 4 98497174 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACATACCTGTGCTGTTGTGTG -3'
(R):5'- GGTCATCCAATAGATCTGAGGAAC -3'

Sequencing Primer
(F):5'- TCGAGTACTGACTCTTCC -3'
(R):5'- TCTGAAGAGTCAACACTAGTGAGTTG -3'
Posted On2019-12-20