Mutagenetix > Incidental Mutations

Incidental Mutation 'R0148:Rgs11'

60887

Institutional Source

Beutler Lab

Gene Symbol

Rgs11

Ensembl Gene

ENSMUSG00000024186

Gene Name

regulator of G-protein signaling 11

Synonyms

MMRRC Submission

038432-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R0148 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26202951-26211324 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 26207459 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025020] [ENSMUST00000114988] [ENSMUST00000122058]

Predicted Effect

probably null
Transcript: ENSMUST00000025020

SMART Domains

Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186

Domain	Start	End	E-Value	Type
DEP	34	109	7.78e-17	SMART
G_gamma	220	284	1.38e-19	SMART
GGL	223	284	1.1e-26	SMART
RGS	303	418	6.23e-47	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114988

SMART Domains

Protein: ENSMUSP00000110639
Gene: ENSMUSG00000024187

Domain	Start	End	E-Value	Type
transmembrane domain	50	72	N/A	INTRINSIC
low complexity region	218	233	N/A	INTRINSIC
low complexity region	415	425	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000122058

SMART Domains

Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186

Domain	Start	End	E-Value	Type
DEP	32	107	7.78e-17	SMART
G_gamma	218	282	1.38e-19	SMART
GGL	221	282	1.1e-26	SMART
RGS	301	416	6.23e-47	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123670

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126464

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127594

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139639

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146683

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147220

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152299

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152676

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155072

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176847

Meta Mutation Damage Score

0.9496

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 96.0%
20x: 91.8%

Validation Efficiency

86% (30/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RGS (regulator of G protein signaling) family. Members of the RGS family act as GTPase-activating proteins on the alpha subunits of heterotrimeric, signal-transducing G proteins. This protein inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound form. Alternative splicing occurs at this locus and four transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal cone and rod b-wave electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,662,446		probably null	Het
Agtr1a	T	C	13: 30,381,944	S331P	probably benign	Het
Ank1	T	A	8: 23,123,977	N1545K	probably damaging	Het
Bahcc1	A	T	11: 120,268,404	Q152H	probably damaging	Het
Bend3	T	A	10: 43,511,950	Y780N	probably damaging	Het
Bod1l	G	T	5: 41,818,697	A1758E	possibly damaging	Het
Ctcfl	T	C	2: 173,118,547	D81G	possibly damaging	Het
Ddx39	C	T	8: 83,722,476	R298C	possibly damaging	Het
Dock8	T	C	19: 25,119,459	L577P	probably benign	Het
Drc1	A	T	5: 30,281,489	N13I	possibly damaging	Het
Efl1	T	C	7: 82,671,670	S104P	probably damaging	Het
Eml4	T	A	17: 83,421,652	N85K	probably damaging	Het
Epb41l4a	T	C	18: 33,798,800	T581A	probably damaging	Het
Epha3	T	C	16: 63,612,944	D446G	possibly damaging	Het
Fam209	G	T	2: 172,473,980	G92C	probably damaging	Het
Fbln1	G	A	15: 85,230,826	R193H	probably damaging	Het
Fbxw21	A	G	9: 109,148,017		probably null	Het
Fgf17	C	T	14: 70,638,873	R49Q	probably damaging	Het
Flnb	T	C	14: 7,939,077	S2307P	probably benign	Het
Galr1	A	G	18: 82,405,570	L194P	probably benign	Het
Gar1	T	C	3: 129,829,473	H89R	probably damaging	Het
Gbp4	T	A	5: 105,119,496	Y519F	probably benign	Het
Git1	A	G	11: 77,505,728	T601A	probably benign	Het
Gm10722	T	"C,A"	9: 3,001,405		probably null	Het
Gm5142	C	T	14: 59,178,670	R13H	possibly damaging	Het
Gria2	A	C	3: 80,707,731	W481G	probably damaging	Het
Homer2	T	C	7: 81,624,278	T57A	probably benign	Het
Hpse2	A	C	19: 42,931,660		probably null	Het
Hspb7	T	C	4: 141,423,991	I148T	probably damaging	Het
Htr1d	C	A	4: 136,443,477	T339K	probably damaging	Het
Il4ra	T	A	7: 125,575,537	C306S	probably damaging	Het
Kansl3	A	T	1: 36,353,816	C225S	probably damaging	Het
Lama3	G	A	18: 12,448,272	C596Y	probably damaging	Het
Lama5	T	C	2: 180,190,406	H1714R	probably benign	Het
March6	C	T	15: 31,490,612	V293M	probably damaging	Het
Med12l	A	G	3: 59,037,654	D100G	probably damaging	Het
Mettl14	G	A	3: 123,371,394	T316I	probably damaging	Het
Mmp15	A	T	8: 95,372,317	N591Y	probably benign	Het
Mrpl53	T	C	6: 83,109,537	L74P	probably damaging	Het
Mvp	C	T	7: 126,989,865	V577M	probably damaging	Het
Neb	T	C	2: 52,249,376	K140E	probably damaging	Het
Nfya	A	G	17: 48,398,998	V48A	possibly damaging	Het
Ngf	G	T	3: 102,509,803		probably benign	Het
Nipsnap3b	C	T	4: 53,017,088	A104V	possibly damaging	Het
Nlrp14	A	G	7: 107,182,721	Y375C	probably benign	Het
Nod1	A	G	6: 54,938,217	Y764H	probably damaging	Het
Olfr225	G	A	11: 59,613,494	V177M	probably damaging	Het
Olfr270	A	T	4: 52,971,232	I204F	probably benign	Het
Olfr873	T	G	9: 20,301,091	M297R	probably damaging	Het
Pcdhb19	A	T	18: 37,497,182	Q10L	probably benign	Het
Pdcl	T	C	2: 37,352,130	I203V	probably benign	Het
Peg10	C	A	6: 4,755,711	R96S	possibly damaging	Het
Pknox1	T	A	17: 31,604,790	N379K	probably benign	Het
Prodh	T	G	16: 18,077,813	Q360P	probably damaging	Het
Raf1	C	T	6: 115,632,973	G202S	probably benign	Het
Rilp	A	T	11: 75,510,233	H29L	probably damaging	Het
Rtel1	T	C	2: 181,321,046	C31R	probably damaging	Het
Rubcnl	T	A	14: 75,042,458	I427K	probably damaging	Het
Ryr1	C	A	7: 29,052,035	R3706L	probably damaging	Het
Ryr2	T	C	13: 11,714,548	D2396G	probably damaging	Het
Slc45a2	T	C	15: 11,025,868	S435P	probably damaging	Het
Spata17	A	G	1: 187,112,601	V111A	probably damaging	Het
Svep1	C	T	4: 58,116,608	D881N	possibly damaging	Het
Sypl2	T	A	3: 108,219,095	N67I	possibly damaging	Het
Tenm3	T	C	8: 48,236,720	Y1944C	probably damaging	Het
Tep1	A	T	14: 50,824,789	D2535E	possibly damaging	Het
Tkt	T	A	14: 30,572,220	I529N	probably damaging	Het
Trp53i11	T	G	2: 93,197,735	V39G	probably damaging	Het
Trpm2	C	T	10: 77,925,825	G997D	probably damaging	Het
Usp3	A	G	9: 66,540,167	V219A	possibly damaging	Het
Usp4	T	A	9: 108,391,671		probably null	Het
Wdfy3	A	G	5: 101,917,411	V1297A	probably benign	Het
Wdr46	T	A	17: 33,941,023	F70I	probably benign	Het
Xkr6	T	C	14: 63,819,549	V303A	unknown	Het
Zdbf2	C	T	1: 63,304,006	Q515*	probably null	Het
Zfhx2	A	G	14: 55,072,897	Y731H	possibly damaging	Het

Other mutations in Rgs11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Rgs11	APN	17	26207397	missense	probably damaging	1.00
IGL01617:Rgs11	APN	17	26208250	missense	probably damaging	1.00
IGL02150:Rgs11	APN	17	26202994	missense	probably benign	0.05
IGL02610:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02612:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02617:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02669:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02670:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02674:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02706:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02707:Rgs11	APN	17	26207631	missense	probably benign	0.31
IGL02741:Rgs11	APN	17	26207631	missense	probably benign	0.31
R0147:Rgs11	UTSW	17	26207459	critical splice donor site	probably null
R0508:Rgs11	UTSW	17	26207469	splice site	probably benign
R0744:Rgs11	UTSW	17	26203318	missense	probably damaging	1.00
R1479:Rgs11	UTSW	17	26208283	unclassified	probably null
R1599:Rgs11	UTSW	17	26208249	missense	probably damaging	1.00
R1779:Rgs11	UTSW	17	26210666	missense	probably damaging	1.00
R3692:Rgs11	UTSW	17	26204328	unclassified	probably benign
R3807:Rgs11	UTSW	17	26203500	missense	probably damaging	0.99
R3889:Rgs11	UTSW	17	26207587	missense	probably damaging	0.98
R4689:Rgs11	UTSW	17	26204547	critical splice donor site	probably null
R4832:Rgs11	UTSW	17	26207568	missense	probably benign	0.00
R5052:Rgs11	UTSW	17	26207973	intron	probably benign
R5330:Rgs11	UTSW	17	26202973	start codon destroyed	probably benign	0.01
R5331:Rgs11	UTSW	17	26202973	start codon destroyed	probably benign	0.01
R5683:Rgs11	UTSW	17	26205181	missense	probably benign	0.32
R5879:Rgs11	UTSW	17	26203463	unclassified	probably benign
R6156:Rgs11	UTSW	17	26210465	nonsense	probably null
R6671:Rgs11	UTSW	17	26208298	missense	probably damaging	1.00
R7432:Rgs11	UTSW	17	26207760	missense	probably damaging	0.99
R7609:Rgs11	UTSW	17	26207441	missense	probably damaging	1.00
R7795:Rgs11	UTSW	17	26207578	missense	possibly damaging	0.88
Z1088:Rgs11	UTSW	17	26205772	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCTGTGTAACCCAAGCCAACTG -3'
(R):5'- GGGCATTTAACAAAGGCACCCAAAG -3'

Sequencing Primer
(F):5'- AACTGTGTCTTTCAGACCTAGAGC -3'
(R):5'- ATTCATGGCCCAGTAGGTGAC -3'

Posted On

2013-07-24