Incidental Mutation 'R7883:Gcnt3'
ID608897
Institutional Source Beutler Lab
Gene Symbol Gcnt3
Ensembl Gene ENSMUSG00000032226
Gene Nameglucosaminyl (N-acetyl) transferase 3, mucin type
Synonyms2010013H22Rik, 2210021I22Rik, 2210401J11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7883 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location70031496-70038088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70034171 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 372 (I372F)
Ref Sequence ENSEMBL: ENSMUSP00000034751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034751]
Predicted Effect probably damaging
Transcript: ENSMUST00000034751
AA Change: I372F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034751
Gene: ENSMUSG00000032226
AA Change: I372F

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Branch 133 401 2.1e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the N-acetylglucosaminyltransferase family. The encoded protein is a beta-6-N-acetylglucosamine-transferase that catalyzes the formation of core 2 and core 4 O-glycans on mucin-type glycoproteins.[provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygote null mice have decreases in core 2 O-glycan structures on cell surfaces, decreased immunoglobulin levels, and disrupted mucosal barrier in the intestines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik A T 4: 124,850,647 W5R unknown Het
4430402I18Rik A C 19: 28,928,613 S297A probably benign Het
Abcb6 A T 1: 75,178,016 S258R possibly damaging Het
Abcc10 A G 17: 46,307,101 V1082A probably benign Het
Adrb2 A G 18: 62,179,376 V126A probably damaging Het
Apol11a A G 15: 77,516,574 E87G probably damaging Het
Arhgap45 T A 10: 80,027,589 C755* probably null Het
Arl13b A T 16: 62,827,266 I93K probably damaging Het
Aspm A G 1: 139,478,667 K1764R possibly damaging Het
Atp8b5 A G 4: 43,342,471 I381V probably damaging Het
Atxn2 A G 5: 121,802,117 H985R possibly damaging Het
Bms1 G T 6: 118,388,774 N1150K probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camta2 T C 11: 70,675,211 D749G probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cep152 G A 2: 125,613,058 A274V possibly damaging Het
Chd7 A G 4: 8,826,504 N956S probably damaging Het
Cpt1c A T 7: 44,964,014 probably null Het
Cttn C T 7: 144,445,818 V338I probably benign Het
Dab2ip G A 2: 35,720,206 G811D possibly damaging Het
Dmtf1 T C 5: 9,140,397 T106A probably benign Het
Dync2h1 T C 9: 7,005,566 E3768G possibly damaging Het
Exoc1 T A 5: 76,561,382 D612E probably damaging Het
Fat2 T C 11: 55,253,364 probably null Het
Fat4 G A 3: 38,981,819 E3207K probably damaging Het
Fbxw18 A G 9: 109,688,406 Y410H probably damaging Het
Fgfr3 T A 5: 33,733,891 S518T probably damaging Het
Fzr1 G A 10: 81,368,635 T377M probably damaging Het
Gm10577 A T 4: 101,020,522 Y59N unknown Het
Gm826 A G 2: 160,327,293 L32P unknown Het
Grid1 T G 14: 35,450,302 probably null Het
Hid1 T A 11: 115,354,609 T457S probably damaging Het
Hsd3b5 A G 3: 98,622,140 V58A probably benign Het
Iqcj A G 3: 68,047,308 K49E probably damaging Het
Itpk1 A G 12: 102,606,175 V93A probably benign Het
Kcnt2 A G 1: 140,523,150 I722M probably damaging Het
Klhl36 T C 8: 119,874,478 V412A possibly damaging Het
Krt18 G A 15: 102,028,450 V58M possibly damaging Het
Lats2 T C 14: 57,697,200 Y691C probably damaging Het
Lrp1b A T 2: 40,665,129 I4095N Het
Map1a A G 2: 121,305,372 E2223G probably damaging Het
Med25 A G 7: 44,891,808 F94L possibly damaging Het
Mertk A G 2: 128,776,345 I499V probably benign Het
Mrps12 A G 7: 28,740,143 L49P probably benign Het
Nwd1 T A 8: 72,667,126 V339D probably damaging Het
Obscn G A 11: 59,070,009 Q3159* probably null Het
Patj G A 4: 98,611,135 V1349I probably benign Het
Pcdha8 T A 18: 36,993,143 V226D probably damaging Het
Pdgfd T A 9: 6,293,939 probably null Het
Pdzd7 A C 19: 45,030,240 I600S probably damaging Het
Pgpep1l G A 7: 68,239,149 R45* probably null Het
Pik3c3 T C 18: 30,274,363 S55P probably benign Het
Pkhd1l1 A T 15: 44,529,126 D1619V probably damaging Het
Pkp1 A G 1: 135,884,903 probably null Het
Ppan T A 9: 20,891,481 I311N probably benign Het
Ppih C A 4: 119,310,790 G175W probably damaging Het
Ppp1r8 G T 4: 132,834,715 Q65K probably damaging Het
Psmd5 T A 2: 34,856,512 K351M possibly damaging Het
Pth1r T C 9: 110,731,558 K53R probably benign Het
Ptprn A T 1: 75,262,363 F9L probably damaging Het
Rgl3 T C 9: 21,981,427 I288V probably benign Het
Sds A G 5: 120,479,213 I45V possibly damaging Het
Sfxn4 A T 19: 60,858,749 probably null Het
Sis A T 3: 72,920,996 C1220S possibly damaging Het
Slc22a16 T G 10: 40,603,664 D577E probably benign Het
Slc25a10 T A 11: 120,494,514 M43K possibly damaging Het
Smpd1 T C 7: 105,556,985 I440T probably damaging Het
St6galnac6 A G 2: 32,614,929 N151S probably benign Het
Taf4 G T 2: 179,929,295 L742M probably damaging Het
Tctn1 A G 5: 122,264,312 S20P possibly damaging Het
Tkfc A T 19: 10,595,030 probably null Het
Tmem270 A G 5: 134,902,827 V87A possibly damaging Het
Tpo T C 12: 30,103,170 H395R probably damaging Het
Tufm T C 7: 126,488,942 F206L possibly damaging Het
Tulp2 A G 7: 45,516,764 probably null Het
Tulp3 G A 6: 128,326,844 T264M probably damaging Het
Uqcrc2 A G 7: 120,645,217 D194G possibly damaging Het
Vill C A 9: 119,065,521 C415* probably null Het
Zfp799 A G 17: 32,820,282 C337R probably damaging Het
Zhx2 A G 15: 57,821,874 E213G possibly damaging Het
Other mutations in Gcnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Gcnt3 APN 9 70034457 missense probably benign 0.20
IGL02617:Gcnt3 APN 9 70034162 missense probably damaging 1.00
IGL02965:Gcnt3 APN 9 70034953 missense probably benign 0.00
IGL03113:Gcnt3 APN 9 70034701 missense probably damaging 1.00
IGL03374:Gcnt3 APN 9 70034413 missense possibly damaging 0.89
PIT4131001:Gcnt3 UTSW 9 70034044 missense possibly damaging 0.80
R0012:Gcnt3 UTSW 9 70034085 missense probably benign 0.04
R0012:Gcnt3 UTSW 9 70034085 missense probably benign 0.04
R1241:Gcnt3 UTSW 9 70034333 missense probably benign 0.01
R1653:Gcnt3 UTSW 9 70035077 missense probably damaging 1.00
R1662:Gcnt3 UTSW 9 70034377 missense probably benign 0.00
R2213:Gcnt3 UTSW 9 70034707 missense probably benign 0.16
R4588:Gcnt3 UTSW 9 70034230 missense probably damaging 1.00
R4927:Gcnt3 UTSW 9 70035182 missense probably damaging 1.00
R5407:Gcnt3 UTSW 9 70034189 missense probably benign 0.00
R5718:Gcnt3 UTSW 9 70034270 missense probably benign 0.00
R6974:Gcnt3 UTSW 9 70034887 missense probably damaging 1.00
R8215:Gcnt3 UTSW 9 70034173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATAGATGGCTTTGTGACG -3'
(R):5'- TCGAGACTTCATTGAACACGTG -3'

Sequencing Primer
(F):5'- TGGCTTTGTGACGTAAATATTCTTC -3'
(R):5'- GTGTTCAGTAACTCAAAAGCCCGG -3'
Posted On2019-12-20