Incidental Mutation 'R7883:Arhgap45'
ID608902
Institutional Source Beutler Lab
Gene Symbol Arhgap45
Ensembl Gene ENSMUSG00000035697
Gene NameRho GTPase activating protein 45
Synonyms6330406L22Rik, Hmha1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7883 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80016653-80031472 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 80027589 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 755 (C755*)
Ref Sequence ENSEMBL: ENSMUSP00000101012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043311] [ENSMUST00000099501] [ENSMUST00000105373]
Predicted Effect probably null
Transcript: ENSMUST00000043311
AA Change: C628*
SMART Domains Protein: ENSMUSP00000041019
Gene: ENSMUSG00000035697
AA Change: C628*

DomainStartEndE-ValueType
low complexity region 142 153 N/A INTRINSIC
FCH 157 244 4.14e-17 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 330 345 N/A INTRINSIC
low complexity region 527 536 N/A INTRINSIC
C1 582 628 3.15e-8 SMART
RhoGAP 653 852 2.73e-73 SMART
low complexity region 856 869 N/A INTRINSIC
Blast:RhoGAP 876 999 1e-21 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000099501
AA Change: C744*
SMART Domains Protein: ENSMUSP00000097100
Gene: ENSMUSG00000035697
AA Change: C744*

DomainStartEndE-ValueType
low complexity region 258 269 N/A INTRINSIC
FCH 273 360 4.14e-17 SMART
low complexity region 371 385 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 446 461 N/A INTRINSIC
low complexity region 643 652 N/A INTRINSIC
C1 698 744 3.15e-8 SMART
RhoGAP 769 968 2.73e-73 SMART
low complexity region 972 985 N/A INTRINSIC
Blast:RhoGAP 992 1115 1e-21 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000105373
AA Change: C755*
SMART Domains Protein: ENSMUSP00000101012
Gene: ENSMUSG00000035697
AA Change: C755*

DomainStartEndE-ValueType
low complexity region 269 280 N/A INTRINSIC
FCH 284 371 4.14e-17 SMART
low complexity region 382 396 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 457 472 N/A INTRINSIC
low complexity region 654 663 N/A INTRINSIC
C1 709 755 3.15e-8 SMART
RhoGAP 780 979 2.73e-73 SMART
low complexity region 983 996 N/A INTRINSIC
Blast:RhoGAP 1003 1126 1e-21 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik A T 4: 124,850,647 W5R unknown Het
4430402I18Rik A C 19: 28,928,613 S297A probably benign Het
Abcb6 A T 1: 75,178,016 S258R possibly damaging Het
Abcc10 A G 17: 46,307,101 V1082A probably benign Het
Adrb2 A G 18: 62,179,376 V126A probably damaging Het
Apol11a A G 15: 77,516,574 E87G probably damaging Het
Arl13b A T 16: 62,827,266 I93K probably damaging Het
Aspm A G 1: 139,478,667 K1764R possibly damaging Het
Atp8b5 A G 4: 43,342,471 I381V probably damaging Het
Atxn2 A G 5: 121,802,117 H985R possibly damaging Het
Bms1 G T 6: 118,388,774 N1150K probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camta2 T C 11: 70,675,211 D749G probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cep152 G A 2: 125,613,058 A274V possibly damaging Het
Chd7 A G 4: 8,826,504 N956S probably damaging Het
Cttn C T 7: 144,445,818 V338I probably benign Het
Dab2ip G A 2: 35,720,206 G811D possibly damaging Het
Dmtf1 T C 5: 9,140,397 T106A probably benign Het
Dync2h1 T C 9: 7,005,566 E3768G possibly damaging Het
Exoc1 T A 5: 76,561,382 D612E probably damaging Het
Fat4 G A 3: 38,981,819 E3207K probably damaging Het
Fbxw18 A G 9: 109,688,406 Y410H probably damaging Het
Fgfr3 T A 5: 33,733,891 S518T probably damaging Het
Fzr1 G A 10: 81,368,635 T377M probably damaging Het
Gcnt3 T A 9: 70,034,171 I372F probably damaging Het
Gm10577 A T 4: 101,020,522 Y59N unknown Het
Gm826 A G 2: 160,327,293 L32P unknown Het
Hid1 T A 11: 115,354,609 T457S probably damaging Het
Hsd3b5 A G 3: 98,622,140 V58A probably benign Het
Iqcj A G 3: 68,047,308 K49E probably damaging Het
Itpk1 A G 12: 102,606,175 V93A probably benign Het
Kcnt2 A G 1: 140,523,150 I722M probably damaging Het
Klhl36 T C 8: 119,874,478 V412A possibly damaging Het
Krt18 G A 15: 102,028,450 V58M possibly damaging Het
Lats2 T C 14: 57,697,200 Y691C probably damaging Het
Lrp1b A T 2: 40,665,129 I4095N Het
Map1a A G 2: 121,305,372 E2223G probably damaging Het
Med25 A G 7: 44,891,808 F94L possibly damaging Het
Mertk A G 2: 128,776,345 I499V probably benign Het
Mrps12 A G 7: 28,740,143 L49P probably benign Het
Nwd1 T A 8: 72,667,126 V339D probably damaging Het
Obscn G A 11: 59,070,009 Q3159* probably null Het
Patj G A 4: 98,611,135 V1349I probably benign Het
Pcdha8 T A 18: 36,993,143 V226D probably damaging Het
Pdgfd T A 9: 6,293,939 probably null Het
Pdzd7 A C 19: 45,030,240 I600S probably damaging Het
Pgpep1l G A 7: 68,239,149 R45* probably null Het
Pik3c3 T C 18: 30,274,363 S55P probably benign Het
Pkhd1l1 A T 15: 44,529,126 D1619V probably damaging Het
Pkp1 A G 1: 135,884,903 probably null Het
Ppan T A 9: 20,891,481 I311N probably benign Het
Ppih C A 4: 119,310,790 G175W probably damaging Het
Ppp1r8 G T 4: 132,834,715 Q65K probably damaging Het
Psmd5 T A 2: 34,856,512 K351M possibly damaging Het
Pth1r T C 9: 110,731,558 K53R probably benign Het
Ptprn A T 1: 75,262,363 F9L probably damaging Het
Rgl3 T C 9: 21,981,427 I288V probably benign Het
Sds A G 5: 120,479,213 I45V possibly damaging Het
Sis A T 3: 72,920,996 C1220S possibly damaging Het
Slc22a16 T G 10: 40,603,664 D577E probably benign Het
Slc25a10 T A 11: 120,494,514 M43K possibly damaging Het
Smpd1 T C 7: 105,556,985 I440T probably damaging Het
St6galnac6 A G 2: 32,614,929 N151S probably benign Het
Taf4 G T 2: 179,929,295 L742M probably damaging Het
Tctn1 A G 5: 122,264,312 S20P possibly damaging Het
Tmem270 A G 5: 134,902,827 V87A possibly damaging Het
Tpo T C 12: 30,103,170 H395R probably damaging Het
Tufm T C 7: 126,488,942 F206L possibly damaging Het
Tulp3 G A 6: 128,326,844 T264M probably damaging Het
Uqcrc2 A G 7: 120,645,217 D194G possibly damaging Het
Vill C A 9: 119,065,521 C415* probably null Het
Zfp799 A G 17: 32,820,282 C337R probably damaging Het
Zhx2 A G 15: 57,821,874 E213G possibly damaging Het
Other mutations in Arhgap45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Arhgap45 APN 10 80028648 splice site probably benign
IGL01414:Arhgap45 APN 10 80027104 missense probably damaging 1.00
IGL01505:Arhgap45 APN 10 80026542 missense probably benign 0.10
IGL02203:Arhgap45 APN 10 80027553 nonsense probably null
IGL02557:Arhgap45 APN 10 80021638 missense probably damaging 1.00
IGL02858:Arhgap45 APN 10 80017934 missense probably benign 0.20
IGL03292:Arhgap45 APN 10 80020969 missense probably benign 0.04
IGL03352:Arhgap45 APN 10 80030751 missense probably damaging 0.96
Celt UTSW 10 80020818 missense probably damaging 1.00
druid UTSW 10 80026347 critical splice donor site probably null
Mistletoe UTSW 10 80027102 nonsense probably null
Roman UTSW 10 80027597 missense probably damaging 1.00
stonehenge UTSW 10 80025482 missense possibly damaging 0.81
IGL03048:Arhgap45 UTSW 10 80017017 missense probably damaging 0.99
PIT4677001:Arhgap45 UTSW 10 80020749 missense probably benign
R0532:Arhgap45 UTSW 10 80022083 missense possibly damaging 0.92
R1233:Arhgap45 UTSW 10 80027582 missense probably damaging 1.00
R1579:Arhgap45 UTSW 10 80028977 missense probably damaging 1.00
R1666:Arhgap45 UTSW 10 80028750 missense possibly damaging 0.82
R1668:Arhgap45 UTSW 10 80028750 missense possibly damaging 0.82
R1688:Arhgap45 UTSW 10 80029095 missense probably damaging 1.00
R1710:Arhgap45 UTSW 10 80018098 nonsense probably null
R1902:Arhgap45 UTSW 10 80025466 missense probably damaging 0.99
R1912:Arhgap45 UTSW 10 80020690 missense probably benign 0.08
R1935:Arhgap45 UTSW 10 80030954 missense probably damaging 1.00
R1936:Arhgap45 UTSW 10 80030954 missense probably damaging 1.00
R1955:Arhgap45 UTSW 10 80026492 missense probably benign 0.15
R1968:Arhgap45 UTSW 10 80027702 missense probably damaging 1.00
R1977:Arhgap45 UTSW 10 80020818 missense probably damaging 1.00
R1986:Arhgap45 UTSW 10 80020696 missense probably damaging 1.00
R2074:Arhgap45 UTSW 10 80027180 missense probably damaging 1.00
R2081:Arhgap45 UTSW 10 80027674 missense probably damaging 1.00
R2162:Arhgap45 UTSW 10 80016979 start codon destroyed probably null 0.02
R2937:Arhgap45 UTSW 10 80029002 missense probably damaging 1.00
R2938:Arhgap45 UTSW 10 80029002 missense probably damaging 1.00
R3081:Arhgap45 UTSW 10 80026447 missense probably damaging 1.00
R4695:Arhgap45 UTSW 10 80025530 missense probably damaging 1.00
R4736:Arhgap45 UTSW 10 80026172 missense probably damaging 1.00
R4758:Arhgap45 UTSW 10 80030293 missense probably benign 0.00
R4860:Arhgap45 UTSW 10 80027066 missense probably damaging 1.00
R4860:Arhgap45 UTSW 10 80027066 missense probably damaging 1.00
R4934:Arhgap45 UTSW 10 80020957 missense probably damaging 1.00
R4943:Arhgap45 UTSW 10 80026503 missense probably benign 0.00
R5102:Arhgap45 UTSW 10 80021428 missense probably benign 0.01
R5128:Arhgap45 UTSW 10 80030959 missense probably benign 0.16
R5667:Arhgap45 UTSW 10 80025476 missense probably damaging 1.00
R5671:Arhgap45 UTSW 10 80025476 missense probably damaging 1.00
R5920:Arhgap45 UTSW 10 80029131 missense possibly damaging 0.87
R5998:Arhgap45 UTSW 10 80030950 missense probably damaging 0.99
R6276:Arhgap45 UTSW 10 80026234 missense probably benign 0.25
R6675:Arhgap45 UTSW 10 80018104 missense probably null 0.98
R6738:Arhgap45 UTSW 10 80027597 missense probably damaging 1.00
R6783:Arhgap45 UTSW 10 80017864 missense possibly damaging 0.92
R6863:Arhgap45 UTSW 10 80017782 missense probably benign 0.03
R6978:Arhgap45 UTSW 10 80021848 missense probably benign 0.00
R7089:Arhgap45 UTSW 10 80026347 critical splice donor site probably null
R7215:Arhgap45 UTSW 10 80025482 missense possibly damaging 0.81
R7307:Arhgap45 UTSW 10 80029182 missense probably benign 0.14
R7308:Arhgap45 UTSW 10 80026558 critical splice donor site probably null
R7480:Arhgap45 UTSW 10 80027102 nonsense probably null
R7481:Arhgap45 UTSW 10 80022300 missense possibly damaging 0.80
R7649:Arhgap45 UTSW 10 80031001 missense probably benign 0.00
R7652:Arhgap45 UTSW 10 80028838 missense probably benign 0.01
R7748:Arhgap45 UTSW 10 80016932 unclassified probably benign
R7966:Arhgap45 UTSW 10 80027589 nonsense probably null
X0023:Arhgap45 UTSW 10 80030800 missense probably damaging 0.98
X0063:Arhgap45 UTSW 10 80030356 missense possibly damaging 0.51
Z1176:Arhgap45 UTSW 10 80025536 missense probably damaging 1.00
Z1176:Arhgap45 UTSW 10 80029052 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTCTGACAAGGTTCTCCAGG -3'
(R):5'- TTTTCACGCCATTGACCCGG -3'

Sequencing Primer
(F):5'- TGACAAGGTTCTCCAGGTGCAG -3'
(R):5'- AGCATTGCACCAGCTCTG -3'
Posted On2019-12-20