Incidental Mutation 'R7883:Slc25a10'
ID608908
Institutional Source Beutler Lab
Gene Symbol Slc25a10
Ensembl Gene ENSMUSG00000025792
Gene Namesolute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10
SynonymsDic
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7883 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location120491840-120499187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120494514 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 43 (M43K)
Ref Sequence ENSEMBL: ENSMUSP00000026899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026899]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026899
AA Change: M43K

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026899
Gene: ENSMUSG00000025792
AA Change: M43K

DomainStartEndE-ValueType
Pfam:Mito_carr 5 92 4.1e-20 PFAM
Pfam:Mito_carr 94 191 2e-18 PFAM
Pfam:Mito_carr 195 284 7.2e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that translocate small metabolites across the mitochondrial membrane. The encoded protein exchanges dicarboxylates, such as malate and succinate, for phosphate, sulfate, and other small molecules, thereby providing substrates for metabolic processes including the Krebs cycle and fatty acid synthesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik A T 4: 124,850,647 W5R unknown Het
4430402I18Rik A C 19: 28,928,613 S297A probably benign Het
Abcb6 A T 1: 75,178,016 S258R possibly damaging Het
Abcc10 A G 17: 46,307,101 V1082A probably benign Het
Adrb2 A G 18: 62,179,376 V126A probably damaging Het
Apol11a A G 15: 77,516,574 E87G probably damaging Het
Arhgap45 T A 10: 80,027,589 C755* probably null Het
Arl13b A T 16: 62,827,266 I93K probably damaging Het
Aspm A G 1: 139,478,667 K1764R possibly damaging Het
Atp8b5 A G 4: 43,342,471 I381V probably damaging Het
Atxn2 A G 5: 121,802,117 H985R possibly damaging Het
Bms1 G T 6: 118,388,774 N1150K probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camta2 T C 11: 70,675,211 D749G probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cep152 G A 2: 125,613,058 A274V possibly damaging Het
Chd7 A G 4: 8,826,504 N956S probably damaging Het
Cttn C T 7: 144,445,818 V338I probably benign Het
Dab2ip G A 2: 35,720,206 G811D possibly damaging Het
Dmtf1 T C 5: 9,140,397 T106A probably benign Het
Dync2h1 T C 9: 7,005,566 E3768G possibly damaging Het
Exoc1 T A 5: 76,561,382 D612E probably damaging Het
Fat4 G A 3: 38,981,819 E3207K probably damaging Het
Fbxw18 A G 9: 109,688,406 Y410H probably damaging Het
Fgfr3 T A 5: 33,733,891 S518T probably damaging Het
Fzr1 G A 10: 81,368,635 T377M probably damaging Het
Gcnt3 T A 9: 70,034,171 I372F probably damaging Het
Gm10577 A T 4: 101,020,522 Y59N unknown Het
Gm826 A G 2: 160,327,293 L32P unknown Het
Hid1 T A 11: 115,354,609 T457S probably damaging Het
Hsd3b5 A G 3: 98,622,140 V58A probably benign Het
Iqcj A G 3: 68,047,308 K49E probably damaging Het
Itpk1 A G 12: 102,606,175 V93A probably benign Het
Kcnt2 A G 1: 140,523,150 I722M probably damaging Het
Klhl36 T C 8: 119,874,478 V412A possibly damaging Het
Krt18 G A 15: 102,028,450 V58M possibly damaging Het
Lats2 T C 14: 57,697,200 Y691C probably damaging Het
Lrp1b A T 2: 40,665,129 I4095N Het
Map1a A G 2: 121,305,372 E2223G probably damaging Het
Med25 A G 7: 44,891,808 F94L possibly damaging Het
Mertk A G 2: 128,776,345 I499V probably benign Het
Mrps12 A G 7: 28,740,143 L49P probably benign Het
Nwd1 T A 8: 72,667,126 V339D probably damaging Het
Obscn G A 11: 59,070,009 Q3159* probably null Het
Patj G A 4: 98,611,135 V1349I probably benign Het
Pcdha8 T A 18: 36,993,143 V226D probably damaging Het
Pdgfd T A 9: 6,293,939 probably null Het
Pdzd7 A C 19: 45,030,240 I600S probably damaging Het
Pgpep1l G A 7: 68,239,149 R45* probably null Het
Pik3c3 T C 18: 30,274,363 S55P probably benign Het
Pkhd1l1 A T 15: 44,529,126 D1619V probably damaging Het
Pkp1 A G 1: 135,884,903 probably null Het
Ppan T A 9: 20,891,481 I311N probably benign Het
Ppih C A 4: 119,310,790 G175W probably damaging Het
Ppp1r8 G T 4: 132,834,715 Q65K probably damaging Het
Psmd5 T A 2: 34,856,512 K351M possibly damaging Het
Pth1r T C 9: 110,731,558 K53R probably benign Het
Ptprn A T 1: 75,262,363 F9L probably damaging Het
Rgl3 T C 9: 21,981,427 I288V probably benign Het
Sds A G 5: 120,479,213 I45V possibly damaging Het
Sis A T 3: 72,920,996 C1220S possibly damaging Het
Slc22a16 T G 10: 40,603,664 D577E probably benign Het
Smpd1 T C 7: 105,556,985 I440T probably damaging Het
St6galnac6 A G 2: 32,614,929 N151S probably benign Het
Taf4 G T 2: 179,929,295 L742M probably damaging Het
Tctn1 A G 5: 122,264,312 S20P possibly damaging Het
Tmem270 A G 5: 134,902,827 V87A possibly damaging Het
Tpo T C 12: 30,103,170 H395R probably damaging Het
Tufm T C 7: 126,488,942 F206L possibly damaging Het
Tulp3 G A 6: 128,326,844 T264M probably damaging Het
Uqcrc2 A G 7: 120,645,217 D194G possibly damaging Het
Vill C A 9: 119,065,521 C415* probably null Het
Zfp799 A G 17: 32,820,282 C337R probably damaging Het
Zhx2 A G 15: 57,821,874 E213G possibly damaging Het
Other mutations in Slc25a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Slc25a10 APN 11 120497107 critical splice donor site probably null
IGL00816:Slc25a10 APN 11 120495150 splice site probably benign
IGL02448:Slc25a10 APN 11 120497053 missense probably benign 0.01
R2291:Slc25a10 UTSW 11 120497074 missense probably benign
R2860:Slc25a10 UTSW 11 120495177 missense probably damaging 0.98
R2861:Slc25a10 UTSW 11 120495177 missense probably damaging 0.98
R3938:Slc25a10 UTSW 11 120491993 nonsense probably null
R4019:Slc25a10 UTSW 11 120497439 missense probably damaging 0.99
R4020:Slc25a10 UTSW 11 120497439 missense probably damaging 0.99
R4457:Slc25a10 UTSW 11 120497089 missense probably benign
R4542:Slc25a10 UTSW 11 120497981 splice site probably null
R5643:Slc25a10 UTSW 11 120496376 intron probably benign
R5869:Slc25a10 UTSW 11 120498117 missense probably damaging 0.98
R6032:Slc25a10 UTSW 11 120494958 critical splice acceptor site probably null
R6032:Slc25a10 UTSW 11 120494958 critical splice acceptor site probably null
R6455:Slc25a10 UTSW 11 120495205 missense probably damaging 1.00
R6574:Slc25a10 UTSW 11 120497077 missense probably benign
R6954:Slc25a10 UTSW 11 120498147 missense probably benign
R7302:Slc25a10 UTSW 11 120491956 unclassified probably benign
R7618:Slc25a10 UTSW 11 120496971 intron probably null
R7671:Slc25a10 UTSW 11 120495460 missense probably benign 0.18
R7966:Slc25a10 UTSW 11 120494514 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TGACAGCATGGAGTCCACAG -3'
(R):5'- TAGCTGAAACTCCCTAAGGCTCC -3'

Sequencing Primer
(F):5'- GGGGACAGACCTGGAAATAATTCATC -3'
(R):5'- TAAGGCTCCTTCCTAGGACTGAG -3'
Posted On2019-12-20