Incidental Mutation 'R7884:Dnah7c'
ID608924
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Namedynein, axonemal, heavy chain 7C
SynonymsDnahc7c
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R7884 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location46425592-46807476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46791769 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 3813 (L3813F)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
Predicted Effect probably benign
Transcript: ENSMUST00000189749
AA Change: L3813F

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: L3813F

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,602,231 T1158A probably damaging Het
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 Y172F probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Etnk2 T C 1: 133,365,700 V127A possibly damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
Gnb3 T C 6: 124,837,092 T178A probably benign Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Mars A G 10: 127,300,245 I525T probably damaging Het
Miga2 T A 2: 30,371,204 D170E probably benign Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nr2f1 G A 13: 78,189,869 T376I probably benign Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Omd A G 13: 49,590,154 M227V probably damaging Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Pou2f2 T C 7: 25,116,064 M93V probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Sipa1l2 T A 8: 125,447,598 M1314L probably benign Het
Slc23a1 A G 18: 35,625,949 F63S possibly damaging Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCAGTAGCTTCTAAGTAGCCATG -3'
(R):5'- TTCTGATGTGGAAAGTGAAGCC -3'

Sequencing Primer
(F):5'- GTAGCTTCTAAGTAGCCATGTATTG -3'
(R):5'- GAAGTTAGTTAGACATCAGTGTGC -3'
Posted On2019-12-20