Incidental Mutation 'R7884:Miga2'
ID608929
Institutional Source Beutler Lab
Gene Symbol Miga2
Ensembl Gene ENSMUSG00000026858
Gene Namemitoguardin 2
SynonymsFam73b, R74766, 5730472N09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7884 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30364233-30385521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30371204 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 170 (D170E)
Ref Sequence ENSEMBL: ENSMUSP00000077127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077977] [ENSMUST00000100214] [ENSMUST00000116543] [ENSMUST00000140075] [ENSMUST00000142801]
Predicted Effect probably benign
Transcript: ENSMUST00000077977
AA Change: D170E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000077127
Gene: ENSMUSG00000026858
AA Change: D170E

DomainStartEndE-ValueType
Pfam:DUF2217 30 568 5.6e-242 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100214
AA Change: D170E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097787
Gene: ENSMUSG00000026858
AA Change: D170E

DomainStartEndE-ValueType
Pfam:DUF2217 31 568 6.9e-228 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116543
SMART Domains Protein: ENSMUSP00000135126
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 1 91 3.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140075
AA Change: D170E

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135519
Gene: ENSMUSG00000026858
AA Change: D170E

DomainStartEndE-ValueType
Pfam:DUF2217 30 393 5.1e-125 PFAM
low complexity region 409 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142801
SMART Domains Protein: ENSMUSP00000118253
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 30 139 4.1e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,602,231 T1158A probably damaging Het
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 Y172F probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Dnah7c C T 1: 46,791,769 L3813F probably benign Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Etnk2 T C 1: 133,365,700 V127A possibly damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
Gnb3 T C 6: 124,837,092 T178A probably benign Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Mars A G 10: 127,300,245 I525T probably damaging Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nr2f1 G A 13: 78,189,869 T376I probably benign Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Omd A G 13: 49,590,154 M227V probably damaging Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Pou2f2 T C 7: 25,116,064 M93V probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Sipa1l2 T A 8: 125,447,598 M1314L probably benign Het
Slc23a1 A G 18: 35,625,949 F63S possibly damaging Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Miga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Miga2 APN 2 30367717 missense probably benign 0.04
IGL01353:Miga2 APN 2 30371233 critical splice donor site probably null
IGL01679:Miga2 APN 2 30378250 missense probably benign 0.07
IGL03113:Miga2 APN 2 30384010 missense possibly damaging 0.96
uncertain UTSW 2 30371196 missense probably benign 0.00
R0620:Miga2 UTSW 2 30381744 unclassified probably benign
R1698:Miga2 UTSW 2 30377997 missense probably damaging 1.00
R1729:Miga2 UTSW 2 30368968 missense probably damaging 1.00
R1994:Miga2 UTSW 2 30381988 missense probably damaging 1.00
R2377:Miga2 UTSW 2 30383990 nonsense probably null
R2891:Miga2 UTSW 2 30378294 splice site probably null
R2892:Miga2 UTSW 2 30378294 splice site probably null
R2893:Miga2 UTSW 2 30378294 splice site probably null
R3788:Miga2 UTSW 2 30371225 nonsense probably null
R4042:Miga2 UTSW 2 30367726 missense possibly damaging 0.87
R5214:Miga2 UTSW 2 30371196 missense probably benign 0.00
R5750:Miga2 UTSW 2 30371565 missense probably damaging 1.00
R5928:Miga2 UTSW 2 30368863 splice site probably benign
R6134:Miga2 UTSW 2 30371217 missense probably benign 0.00
R6209:Miga2 UTSW 2 30381662 missense probably damaging 1.00
R6860:Miga2 UTSW 2 30371163 missense probably benign 0.15
R7373:Miga2 UTSW 2 30382071 missense probably damaging 1.00
R8370:Miga2 UTSW 2 30375743 frame shift probably null
R8371:Miga2 UTSW 2 30375743 frame shift probably null
R8374:Miga2 UTSW 2 30375743 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTATCTAGGAGAGTACCTGTGGC -3'
(R):5'- ACTCTACAGCTGGGTCTTGC -3'

Sequencing Primer
(F):5'- AGAGTACCTGTGGCCTGCG -3'
(R):5'- TGGGCTATCCAGTACTTAGGC -3'
Posted On2019-12-20