Incidental Mutation 'R0148:Pcdhb19'
ID60893
Institutional Source Beutler Lab
Gene Symbol Pcdhb19
Ensembl Gene ENSMUSG00000043313
Gene Nameprotocadherin beta 19
SynonymsPcdhbS, Pcdhb11
MMRRC Submission 038432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0148 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37496991-37504128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37497182 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 10 (Q10L)
Ref Sequence ENSEMBL: ENSMUSP00000053326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055949] [ENSMUST00000059571] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000055949
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059571
AA Change: Q10L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000053326
Gene: ENSMUSG00000043313
AA Change: Q10L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 45 131 4.8e-1 SMART
CA 155 240 6.58e-20 SMART
CA 264 345 1.03e-21 SMART
CA 368 449 4.21e-18 SMART
CA 473 559 3.36e-26 SMART
CA 589 670 6.69e-12 SMART
Pfam:Cadherin_C_2 686 769 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1346 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 86% (30/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,662,446 probably null Het
Agtr1a T C 13: 30,381,944 S331P probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Bahcc1 A T 11: 120,268,404 Q152H probably damaging Het
Bend3 T A 10: 43,511,950 Y780N probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Ctcfl T C 2: 173,118,547 D81G possibly damaging Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Drc1 A T 5: 30,281,489 N13I possibly damaging Het
Efl1 T C 7: 82,671,670 S104P probably damaging Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fbln1 G A 15: 85,230,826 R193H probably damaging Het
Fbxw21 A G 9: 109,148,017 probably null Het
Fgf17 C T 14: 70,638,873 R49Q probably damaging Het
Flnb T C 14: 7,939,077 S2307P probably benign Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Git1 A G 11: 77,505,728 T601A probably benign Het
Gm10722 T "C,A" 9: 3,001,405 probably null Het
Gm5142 C T 14: 59,178,670 R13H possibly damaging Het
Gria2 A C 3: 80,707,731 W481G probably damaging Het
Homer2 T C 7: 81,624,278 T57A probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Il4ra T A 7: 125,575,537 C306S probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Lama3 G A 18: 12,448,272 C596Y probably damaging Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
March6 C T 15: 31,490,612 V293M probably damaging Het
Med12l A G 3: 59,037,654 D100G probably damaging Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mrpl53 T C 6: 83,109,537 L74P probably damaging Het
Mvp C T 7: 126,989,865 V577M probably damaging Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nipsnap3b C T 4: 53,017,088 A104V possibly damaging Het
Nlrp14 A G 7: 107,182,721 Y375C probably benign Het
Nod1 A G 6: 54,938,217 Y764H probably damaging Het
Olfr225 G A 11: 59,613,494 V177M probably damaging Het
Olfr270 A T 4: 52,971,232 I204F probably benign Het
Olfr873 T G 9: 20,301,091 M297R probably damaging Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Peg10 C A 6: 4,755,711 R96S possibly damaging Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rilp A T 11: 75,510,233 H29L probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Ryr1 C A 7: 29,052,035 R3706L probably damaging Het
Ryr2 T C 13: 11,714,548 D2396G probably damaging Het
Slc45a2 T C 15: 11,025,868 S435P probably damaging Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Svep1 C T 4: 58,116,608 D881N possibly damaging Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tep1 A T 14: 50,824,789 D2535E possibly damaging Het
Tkt T A 14: 30,572,220 I529N probably damaging Het
Trp53i11 T G 2: 93,197,735 V39G probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Usp3 A G 9: 66,540,167 V219A possibly damaging Het
Usp4 T A 9: 108,391,671 probably null Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Xkr6 T C 14: 63,819,549 V303A unknown Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Zfhx2 A G 14: 55,072,897 Y731H possibly damaging Het
Other mutations in Pcdhb19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Pcdhb19 APN 18 37497989 missense probably damaging 1.00
IGL02070:Pcdhb19 APN 18 37498544 missense probably damaging 1.00
IGL02348:Pcdhb19 APN 18 37498808 missense probably damaging 1.00
IGL02866:Pcdhb19 APN 18 37499110 missense possibly damaging 0.91
IGL02869:Pcdhb19 APN 18 37498637 missense probably damaging 0.98
IGL03118:Pcdhb19 APN 18 37499565 intron probably benign
IGL03120:Pcdhb19 APN 18 37498156 missense probably benign 0.09
IGL03135:Pcdhb19 APN 18 37498535 missense probably benign 0.37
IGL03366:Pcdhb19 APN 18 37498612 missense possibly damaging 0.95
R0147:Pcdhb19 UTSW 18 37497182 missense probably benign 0.01
R0432:Pcdhb19 UTSW 18 37499535 missense probably benign 0.01
R0609:Pcdhb19 UTSW 18 37497952 missense probably benign
R1438:Pcdhb19 UTSW 18 37497962 missense probably damaging 1.00
R2255:Pcdhb19 UTSW 18 37497944 missense probably benign 0.00
R2265:Pcdhb19 UTSW 18 37497683 missense probably damaging 0.99
R3500:Pcdhb19 UTSW 18 37497479 nonsense probably null
R3708:Pcdhb19 UTSW 18 37497389 missense probably benign 0.04
R4165:Pcdhb19 UTSW 18 37499190 missense probably benign
R4166:Pcdhb19 UTSW 18 37499190 missense probably benign
R4863:Pcdhb19 UTSW 18 37499108 missense probably benign 0.00
R5217:Pcdhb19 UTSW 18 37497886 missense probably benign 0.00
R5770:Pcdhb19 UTSW 18 37498037 missense possibly damaging 0.73
R6031:Pcdhb19 UTSW 18 37497723 missense probably damaging 1.00
R6031:Pcdhb19 UTSW 18 37497723 missense probably damaging 1.00
R6372:Pcdhb19 UTSW 18 37497366 missense probably benign 0.04
R6454:Pcdhb19 UTSW 18 37499269 missense probably benign 0.43
R6985:Pcdhb19 UTSW 18 37497158 missense probably benign 0.00
R7658:Pcdhb19 UTSW 18 37498981 missense probably damaging 0.99
R7662:Pcdhb19 UTSW 18 37498735 missense probably damaging 0.98
R7910:Pcdhb19 UTSW 18 37497667 missense probably benign 0.43
R7991:Pcdhb19 UTSW 18 37497667 missense probably benign 0.43
R8041:Pcdhb19 UTSW 18 37497314 missense not run
X0062:Pcdhb19 UTSW 18 37497175 missense probably benign
Z1177:Pcdhb19 UTSW 18 37498445 missense not run
Predicted Primers PCR Primer
(F):5'- ACCTGTGAAGACACATGGTGGC -3'
(R):5'- CCAGCGGTTCACTAAGGAGCAAATC -3'

Sequencing Primer
(F):5'- GGAATTACATTAAATGCCGCAGAC -3'
(R):5'- TTATCACTAGAGGCCACTTGAGC -3'
Posted On2013-07-24