Incidental Mutation 'R7884:Cyp7a1'
ID608932
Institutional Source Beutler Lab
Gene Symbol Cyp7a1
Ensembl Gene ENSMUSG00000028240
Gene Namecytochrome P450, family 7, subfamily a, polypeptide 1
Synonymscholesterol 7 alpha hydroxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R7884 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location6265612-6275633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6272697 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 172 (Y172F)
Ref Sequence ENSEMBL: ENSMUSP00000029905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029905]
Predicted Effect probably benign
Transcript: ENSMUST00000029905
AA Change: Y172F

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000029905
Gene: ENSMUSG00000028240
AA Change: Y172F

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 32 497 2.3e-87 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway in the liver, which converts cholesterol to bile acids. This reaction is the rate limiting step and the major site of regulation of bile acid synthesis, which is the primary mechanism for the removal of cholesterol from the body. Polymorphisms in the promoter of this gene are associated with defects in bile acid synthesis. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for disruption of this gene experience severe neonatal and postnatal lethality. Supplementation of the maternal diet with fat soluble vitamins and cholic acid starting before birth alleviates much of the phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,602,231 T1158A probably damaging Het
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Dnah7c C T 1: 46,791,769 L3813F probably benign Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Etnk2 T C 1: 133,365,700 V127A possibly damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
Gnb3 T C 6: 124,837,092 T178A probably benign Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Mars A G 10: 127,300,245 I525T probably damaging Het
Miga2 T A 2: 30,371,204 D170E probably benign Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nr2f1 G A 13: 78,189,869 T376I probably benign Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Omd A G 13: 49,590,154 M227V probably damaging Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Pou2f2 T C 7: 25,116,064 M93V probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Sipa1l2 T A 8: 125,447,598 M1314L probably benign Het
Slc23a1 A G 18: 35,625,949 F63S possibly damaging Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Cyp7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Cyp7a1 APN 4 6275517 missense probably damaging 1.00
IGL01577:Cyp7a1 APN 4 6273618 missense probably damaging 1.00
IGL01723:Cyp7a1 APN 4 6272442 missense probably damaging 1.00
IGL02602:Cyp7a1 APN 4 6272871 missense possibly damaging 0.88
IGL03302:Cyp7a1 APN 4 6273801 missense probably benign 0.05
R1017:Cyp7a1 UTSW 4 6272307 missense probably damaging 1.00
R1737:Cyp7a1 UTSW 4 6272848 missense probably benign 0.00
R2044:Cyp7a1 UTSW 4 6275492 missense probably null 1.00
R2326:Cyp7a1 UTSW 4 6268396 missense probably benign
R2867:Cyp7a1 UTSW 4 6272493 missense probably damaging 0.99
R2867:Cyp7a1 UTSW 4 6272493 missense probably damaging 0.99
R3438:Cyp7a1 UTSW 4 6272769 missense probably damaging 1.00
R4181:Cyp7a1 UTSW 4 6271205 missense probably benign 0.09
R4844:Cyp7a1 UTSW 4 6273655 missense probably damaging 1.00
R5184:Cyp7a1 UTSW 4 6271207 missense probably benign
R5371:Cyp7a1 UTSW 4 6268378 missense probably damaging 1.00
R5613:Cyp7a1 UTSW 4 6272799 missense probably damaging 1.00
R5682:Cyp7a1 UTSW 4 6268429 missense probably benign 0.28
R5987:Cyp7a1 UTSW 4 6268476 missense probably benign 0.05
R5995:Cyp7a1 UTSW 4 6272371 missense possibly damaging 0.74
R6128:Cyp7a1 UTSW 4 6272788 missense possibly damaging 0.80
R6552:Cyp7a1 UTSW 4 6272361 nonsense probably null
R6860:Cyp7a1 UTSW 4 6272587 missense probably damaging 1.00
R7032:Cyp7a1 UTSW 4 6268463 missense possibly damaging 0.94
R7631:Cyp7a1 UTSW 4 6272763 missense possibly damaging 0.89
R8289:Cyp7a1 UTSW 4 6268295 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCTCAGCCAGCCTTTC -3'
(R):5'- AGGCATTTGGACACAGAAGC -3'

Sequencing Primer
(F):5'- CTTTATGTGCGGTCTTGAACAAG -3'
(R):5'- TTTGGACACAGAAGCATAGACC -3'
Posted On2019-12-20