Incidental Mutation 'R7884:Pou2f2'
ID608938
Institutional Source Beutler Lab
Gene Symbol Pou2f2
Ensembl Gene ENSMUSG00000008496
Gene NamePOU domain, class 2, transcription factor 2
SynonymsOct-2, Otf-2, Oct2a, Otf2, Oct2b
MMRRC Submission
Accession Numbers

Genbank: NM_001163554; MGI: 101897

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7884 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location25087344-25179726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25116064 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 93 (M93V)
Ref Sequence ENSEMBL: ENSMUSP00000104056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098679] [ENSMUST00000108413] [ENSMUST00000108415] [ENSMUST00000108416] [ENSMUST00000108417] [ENSMUST00000108418] [ENSMUST00000147146] [ENSMUST00000175774] [ENSMUST00000176408]
Predicted Effect probably benign
Transcript: ENSMUST00000098679
AA Change: M115V

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096276
Gene: ENSMUSG00000008496
AA Change: M115V

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108413
AA Change: M93V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000104051
Gene: ENSMUSG00000008496
AA Change: M93V

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 373 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108415
AA Change: M93V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104053
Gene: ENSMUSG00000008496
AA Change: M93V

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108416
SMART Domains Protein: ENSMUSP00000104054
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 81 97 N/A INTRINSIC
POU 140 214 7.65e-52 SMART
low complexity region 220 233 N/A INTRINSIC
HOX 242 304 3.8e-18 SMART
low complexity region 331 355 N/A INTRINSIC
low complexity region 361 371 N/A INTRINSIC
low complexity region 372 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108417
AA Change: M115V

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104055
Gene: ENSMUSG00000008496
AA Change: M115V

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108418
AA Change: M93V

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104056
Gene: ENSMUSG00000008496
AA Change: M93V

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
low complexity region 490 509 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000147146
AA Change: M59V
SMART Domains Protein: ENSMUSP00000118307
Gene: ENSMUSG00000008496
AA Change: M59V

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
SCOP:d1gkub1 89 123 2e-3 SMART
low complexity region 134 151 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175774
AA Change: M93V

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135075
Gene: ENSMUSG00000008496
AA Change: M93V

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176408
AA Change: M93V

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135326
Gene: ENSMUSG00000008496
AA Change: M93V

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this locus results in failed B cell maturation and death within hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,602,231 T1158A probably damaging Het
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 Y172F probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Dnah7c C T 1: 46,791,769 L3813F probably benign Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Etnk2 T C 1: 133,365,700 V127A possibly damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
Gnb3 T C 6: 124,837,092 T178A probably benign Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Mars A G 10: 127,300,245 I525T probably damaging Het
Miga2 T A 2: 30,371,204 D170E probably benign Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nr2f1 G A 13: 78,189,869 T376I probably benign Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Omd A G 13: 49,590,154 M227V probably damaging Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Sipa1l2 T A 8: 125,447,598 M1314L probably benign Het
Slc23a1 A G 18: 35,625,949 F63S possibly damaging Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Pou2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pou2f2 APN 7 25092700 nonsense probably null
IGL01420:Pou2f2 APN 7 25092952 missense possibly damaging 0.79
IGL02219:Pou2f2 APN 7 25097682 missense probably damaging 1.00
IGL03038:Pou2f2 APN 7 25097152 missense probably damaging 1.00
IGL03173:Pou2f2 APN 7 25099946 splice site probably benign
D3080:Pou2f2 UTSW 7 25097133 splice site probably benign
R0347:Pou2f2 UTSW 7 25097701 missense probably damaging 1.00
R0385:Pou2f2 UTSW 7 25116076 nonsense probably null
R0842:Pou2f2 UTSW 7 25096930 missense probably damaging 1.00
R1665:Pou2f2 UTSW 7 25092724 missense possibly damaging 0.66
R1914:Pou2f2 UTSW 7 25100156 missense possibly damaging 0.71
R1915:Pou2f2 UTSW 7 25100156 missense possibly damaging 0.71
R4076:Pou2f2 UTSW 7 25097288 missense probably damaging 0.98
R4811:Pou2f2 UTSW 7 25097686 nonsense probably null
R4863:Pou2f2 UTSW 7 25097108 intron probably benign
R5362:Pou2f2 UTSW 7 25092895 missense probably benign 0.02
R5995:Pou2f2 UTSW 7 25097444 missense probably damaging 1.00
R6605:Pou2f2 UTSW 7 25093581 missense probably damaging 0.96
R7541:Pou2f2 UTSW 7 25116128 missense probably benign 0.02
R8123:Pou2f2 UTSW 7 25097008 missense possibly damaging 0.83
R8416:Pou2f2 UTSW 7 25116126 nonsense probably null
RF014:Pou2f2 UTSW 7 25115737 missense unknown
Z1177:Pou2f2 UTSW 7 25093176 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATCTGAGTCAAGCAGTTAGGAGAC -3'
(R):5'- TGGTTCACAGGTGGGCATTC -3'

Sequencing Primer
(F):5'- ACACATCTTTTACAGGGCGG -3'
(R):5'- CACAGGTGGGCATTCTCTCTG -3'
Posted On2019-12-20