Incidental Mutation 'R7884:Siglecg'
ID 608939
Institutional Source Beutler Lab
Gene Symbol Siglecg
Ensembl Gene ENSMUSG00000030468
Gene Name sialic acid binding Ig-like lectin G
Synonyms A630096C01Rik, mSiglec-G
MMRRC Submission 045936-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R7884 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 43057623-43067773 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43058703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 152 (V152A)
Ref Sequence ENSEMBL: ENSMUSP00000005592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005592]
AlphaFold Q80ZE3
Predicted Effect probably benign
Transcript: ENSMUST00000005592
AA Change: V152A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: V152A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,422,593 (GRCm39) T1158A probably damaging Het
Arhgap32 A G 9: 32,171,810 (GRCm39) E1530G possibly damaging Het
C3 A G 17: 57,533,264 (GRCm39) F113S probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Csmd1 T C 8: 16,011,418 (GRCm39) N2545S probably damaging Het
Ctsh A G 9: 89,943,476 (GRCm39) D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 (GRCm39) Y172F probably benign Het
Ddx52 A G 11: 83,842,911 (GRCm39) probably null Het
Dmxl1 A G 18: 50,026,474 (GRCm39) T1861A possibly damaging Het
Dnah7c C T 1: 46,830,929 (GRCm39) L3813F probably benign Het
Efl1 A G 7: 82,307,307 (GRCm39) I68V probably damaging Het
Etnk2 T C 1: 133,293,438 (GRCm39) V127A possibly damaging Het
Fank1 G C 7: 133,478,554 (GRCm39) R206P probably damaging Het
Fbxl9 A G 8: 106,042,165 (GRCm39) I221T probably benign Het
Fbxw27 G A 9: 109,618,468 (GRCm39) R73* probably null Het
Fndc1 A T 17: 7,992,029 (GRCm39) S556T unknown Het
Gnb3 T C 6: 124,814,055 (GRCm39) T178A probably benign Het
H2bc12 T C 13: 22,220,225 (GRCm39) S57P probably damaging Het
H2-M10.3 A T 17: 36,677,174 (GRCm39) L326Q probably benign Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Itfg2 T C 6: 128,393,344 (GRCm39) probably benign Het
Kcnma1 G A 14: 23,387,057 (GRCm39) P995L probably benign Het
Lama1 G A 17: 68,076,430 (GRCm39) G1068D Het
Lats1 A T 10: 7,573,290 (GRCm39) K125* probably null Het
Lipg C T 18: 75,081,078 (GRCm39) M334I probably damaging Het
Loxhd1 A T 18: 77,518,909 (GRCm39) E1905V probably damaging Het
Lpin1 C T 12: 16,612,370 (GRCm39) G544D Het
Lyst A T 13: 13,882,268 (GRCm39) N2853I probably benign Het
Mars1 A G 10: 127,136,114 (GRCm39) I525T probably damaging Het
Miga2 T A 2: 30,261,216 (GRCm39) D170E probably benign Het
Mrpl34 T C 8: 71,917,911 (GRCm39) V28A probably benign Het
Muc16 A T 9: 18,553,990 (GRCm39) V4101E unknown Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Myo1f A G 17: 33,817,270 (GRCm39) Y771C probably damaging Het
Nr2f1 G A 13: 78,337,988 (GRCm39) T376I probably benign Het
Nsd1 A G 13: 55,461,068 (GRCm39) T2535A probably damaging Het
Nup98 T A 7: 101,825,556 (GRCm39) T428S probably benign Het
Omd A G 13: 49,743,630 (GRCm39) M227V probably damaging Het
Osbpl7 A C 11: 96,951,283 (GRCm39) I657L possibly damaging Het
Pdgfrb T C 18: 61,205,730 (GRCm39) V572A probably damaging Het
Pik3c3 T C 18: 30,445,624 (GRCm39) V537A probably benign Het
Pou2f2 T C 7: 24,815,489 (GRCm39) M93V probably benign Het
Ppip5k2 T C 1: 97,668,207 (GRCm39) T640A probably benign Het
Ptar1 C T 19: 23,686,158 (GRCm39) P157S probably benign Het
Rapgef2 T A 3: 78,973,933 (GRCm39) D1471V possibly damaging Het
Rgs7 A T 1: 174,977,216 (GRCm39) probably null Het
Rhag A G 17: 41,142,536 (GRCm39) Y247C probably benign Het
Sardh A G 2: 27,129,383 (GRCm39) I305T probably damaging Het
Scn11a A G 9: 119,633,617 (GRCm39) I372T probably benign Het
Scn3a G T 2: 65,366,859 (GRCm39) D54E probably damaging Het
Senp2 A G 16: 21,832,981 (GRCm39) T90A probably benign Het
Serpinh1 C T 7: 98,998,495 (GRCm39) R45H probably benign Het
Sipa1l2 T A 8: 126,174,337 (GRCm39) M1314L probably benign Het
Slc23a1 A G 18: 35,759,002 (GRCm39) F63S possibly damaging Het
Slc25a40 T A 5: 8,492,509 (GRCm39) L133Q probably damaging Het
Slc6a16 A G 7: 44,908,771 (GRCm39) E117G probably damaging Het
Thoc2l T C 5: 104,669,212 (GRCm39) S1245P possibly damaging Het
Tmem235 G A 11: 117,755,033 (GRCm39) V162M probably benign Het
Trank1 A G 9: 111,221,584 (GRCm39) T2774A probably benign Het
Trav10n A T 14: 53,359,587 (GRCm39) H6L probably benign Het
Trav13d-3 G A 14: 53,270,704 (GRCm39) W55* probably null Het
Zfp654 G T 16: 64,672,011 (GRCm39) A2E probably damaging Het
Zkscan5 A C 5: 145,157,676 (GRCm39) H726P probably damaging Het
Other mutations in Siglecg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43,058,481 (GRCm39) missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43,061,219 (GRCm39) missense probably benign 0.02
IGL01806:Siglecg APN 7 43,060,888 (GRCm39) splice site probably null
IGL01947:Siglecg APN 7 43,058,187 (GRCm39) missense probably benign 0.43
IGL02257:Siglecg APN 7 43,061,328 (GRCm39) missense probably benign 0.00
IGL02410:Siglecg APN 7 43,058,253 (GRCm39) missense probably damaging 0.99
IGL02454:Siglecg APN 7 43,058,319 (GRCm39) missense probably benign 0.00
Chamonix UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
Dollywood UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
glowworm UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
Montblanc UTSW 7 43,060,810 (GRCm39) intron probably benign
Shenandoah UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
shenandoah2 UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
Sherando UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
Smokies UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
IGL02988:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 1.00
R0134:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0225:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0480:Siglecg UTSW 7 43,060,550 (GRCm39) missense probably benign 0.42
R1538:Siglecg UTSW 7 43,067,313 (GRCm39) missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43,058,365 (GRCm39) missense probably benign 0.17
R2358:Siglecg UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
R4428:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4429:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43,067,332 (GRCm39) missense probably benign 0.03
R4754:Siglecg UTSW 7 43,061,295 (GRCm39) intron probably benign
R5017:Siglecg UTSW 7 43,060,810 (GRCm39) intron probably benign
R5713:Siglecg UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
R5777:Siglecg UTSW 7 43,058,837 (GRCm39) missense possibly damaging 0.80
R5892:Siglecg UTSW 7 43,061,628 (GRCm39) intron probably benign
R6153:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43,058,178 (GRCm39) missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
R6749:Siglecg UTSW 7 43,058,403 (GRCm39) missense probably benign 0.00
R7066:Siglecg UTSW 7 43,061,166 (GRCm39) missense probably benign 0.40
R8275:Siglecg UTSW 7 43,061,892 (GRCm39) missense probably benign
R8554:Siglecg UTSW 7 43,058,320 (GRCm39) missense probably benign 0.01
R8846:Siglecg UTSW 7 43,061,942 (GRCm39) missense probably benign 0.02
R8873:Siglecg UTSW 7 43,067,448 (GRCm39) missense probably benign 0.00
R8887:Siglecg UTSW 7 43,058,008 (GRCm39) missense probably benign 0.18
R9012:Siglecg UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
R9032:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9048:Siglecg UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
R9085:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9313:Siglecg UTSW 7 43,061,856 (GRCm39) missense probably benign 0.03
R9320:Siglecg UTSW 7 43,058,853 (GRCm39) missense probably benign 0.33
R9745:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 0.98
RF006:Siglecg UTSW 7 43,058,288 (GRCm39) nonsense probably null
Z1177:Siglecg UTSW 7 43,061,446 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTTCAGGCTACAAGTGG -3'
(R):5'- GCTCATTCTAGAGAAGTCCAGC -3'

Sequencing Primer
(F):5'- TTCAGGCTACAAGTGGAAGGTAAG -3'
(R):5'- CTGACATGTGAGCTCAGTATCATG -3'
Posted On 2019-12-20