Incidental Mutation 'R7884:Sipa1l2'
ID 608950
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Name signal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.331) question?
Stock # R7884 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 125418063-125569808 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 125447598 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1314 (M1314L)
Ref Sequence ENSEMBL: ENSMUSP00000104405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
AlphaFold Q80TE4
Predicted Effect probably benign
Transcript: ENSMUST00000108775
AA Change: M1314L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: M1314L

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212168
AA Change: M1314L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212987
AA Change: M1314L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,602,231 T1158A probably damaging Het
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 Y172F probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Dnah7c C T 1: 46,791,769 L3813F probably benign Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Etnk2 T C 1: 133,365,700 V127A possibly damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
Gnb3 T C 6: 124,837,092 T178A probably benign Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Mars A G 10: 127,300,245 I525T probably damaging Het
Miga2 T A 2: 30,371,204 D170E probably benign Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nr2f1 G A 13: 78,189,869 T376I probably benign Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Omd A G 13: 49,590,154 M227V probably damaging Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Pou2f2 T C 7: 25,116,064 M93V probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Slc23a1 A G 18: 35,625,949 F63S possibly damaging Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
Rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 125468339 missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 125482106 missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 125419272 missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 125492290 missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 125464233 missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 125491827 missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 125451988 missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R8057:Sipa1l2 UTSW 8 125468530 missense probably damaging 1.00
R8082:Sipa1l2 UTSW 8 125491809 missense possibly damaging 0.82
R8092:Sipa1l2 UTSW 8 125419168 missense probably benign 0.03
R8247:Sipa1l2 UTSW 8 125422633 missense probably benign 0.29
R8252:Sipa1l2 UTSW 8 125468671 missense probably damaging 1.00
R8386:Sipa1l2 UTSW 8 125492093 missense probably damaging 1.00
R8466:Sipa1l2 UTSW 8 125492246 missense probably damaging 1.00
R8697:Sipa1l2 UTSW 8 125482116 missense probably damaging 1.00
R8725:Sipa1l2 UTSW 8 125450386 missense probably benign 0.28
R8727:Sipa1l2 UTSW 8 125450386 missense probably benign 0.28
R9048:Sipa1l2 UTSW 8 125447726 missense possibly damaging 0.59
R9224:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R9279:Sipa1l2 UTSW 8 125482157 missense probably damaging 1.00
R9392:Sipa1l2 UTSW 8 125468221 missense probably benign
R9574:Sipa1l2 UTSW 8 125442714 missense probably benign
R9591:Sipa1l2 UTSW 8 125492373 missense probably damaging 0.99
R9614:Sipa1l2 UTSW 8 125469826 missense probably null 0.01
R9690:Sipa1l2 UTSW 8 125492257 missense probably benign
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 125447556 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TCTCTGTGGGATCAGATGGC -3'
(R):5'- GACAAGCACTTTGGGTCAGG -3'

Sequencing Primer
(F):5'- ATCAGATGGCTGGGCAGTTAGC -3'
(R):5'- TGCTGGGACTGACCTACATCAAAG -3'
Posted On 2019-12-20