Mutagenetix > Incidental Mutation

Incidental Mutation 'R7884:Lats1'

608957

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

045936-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R7884 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 7697526 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 125 (K125*)

Ref Sequence

ENSEMBL: ENSMUSP00000132078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably null
Transcript: ENSMUST00000040043
AA Change: K125*

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: K125*

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000165952
AA Change: K125*

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: K125*

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000217931
AA Change: K125*

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap31	T	C	16: 38,602,231	T1158A	probably damaging	Het
Arhgap32	A	G	9: 32,260,514	E1530G	possibly damaging	Het
BC005561	T	C	5: 104,521,346	S1245P	possibly damaging	Het
C3	A	G	17: 57,226,264	F113S	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Csmd1	T	C	8: 15,961,418	N2545S	probably damaging	Het
Ctsh	A	G	9: 90,061,423	D49G	probably benign	Het
Cyp7a1	T	A	4: 6,272,697	Y172F	probably benign	Het
Ddx52	A	G	11: 83,952,085		probably null	Het
Dmxl1	A	G	18: 49,893,407	T1861A	possibly damaging	Het
Dnah7c	C	T	1: 46,791,769	L3813F	probably benign	Het
Efl1	A	G	7: 82,658,099	I68V	probably damaging	Het
Etnk2	T	C	1: 133,365,700	V127A	possibly damaging	Het
Fank1	G	C	7: 133,876,825	R206P	probably damaging	Het
Fbxw27	G	A	9: 109,789,400	R73*	probably null	Het
Fndc1	A	T	17: 7,773,197	S556T	unknown	Het
Gnb3	T	C	6: 124,837,092	T178A	probably benign	Het
H2-M10.3	A	T	17: 36,366,282	L326Q	probably benign	Het
Hist1h2bk	T	C	13: 22,036,055	S57P	probably damaging	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Itfg2	T	C	6: 128,416,381		probably benign	Het
Kcnma1	G	A	14: 23,336,989	P995L	probably benign	Het
Lama1	G	A	17: 67,769,435	G1068D		Het
Lipg	C	T	18: 74,948,007	M334I	probably damaging	Het
Loxhd1	A	T	18: 77,431,213	E1905V	probably damaging	Het
Lpin1	C	T	12: 16,562,369	G544D		Het
Lrrc29	A	G	8: 105,315,533	I221T	probably benign	Het
Lyst	A	T	13: 13,707,683	N2853I	probably benign	Het
Mars	A	G	10: 127,300,245	I525T	probably damaging	Het
Miga2	T	A	2: 30,371,204	D170E	probably benign	Het
Mrpl34	T	C	8: 71,465,267	V28A	probably benign	Het
Muc16	A	T	9: 18,642,694	V4101E	unknown	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Myo1f	A	G	17: 33,598,296	Y771C	probably damaging	Het
Nr2f1	G	A	13: 78,189,869	T376I	probably benign	Het
Nsd1	A	G	13: 55,313,255	T2535A	probably damaging	Het
Nup98	T	A	7: 102,176,349	T428S	probably benign	Het
Omd	A	G	13: 49,590,154	M227V	probably damaging	Het
Osbpl7	A	C	11: 97,060,457	I657L	possibly damaging	Het
Pdgfrb	T	C	18: 61,072,658	V572A	probably damaging	Het
Pik3c3	T	C	18: 30,312,571	V537A	probably benign	Het
Pou2f2	T	C	7: 25,116,064	M93V	probably benign	Het
Ppip5k2	T	C	1: 97,740,482	T640A	probably benign	Het
Ptar1	C	T	19: 23,708,794	P157S	probably benign	Het
Rapgef2	T	A	3: 79,066,626	D1471V	possibly damaging	Het
Rgs7	A	T	1: 175,149,650		probably null	Het
Rhag	A	G	17: 40,831,645	Y247C	probably benign	Het
Sardh	A	G	2: 27,239,371	I305T	probably damaging	Het
Scn11a	A	G	9: 119,804,551	I372T	probably benign	Het
Scn3a	G	T	2: 65,536,515	D54E	probably damaging	Het
Senp2	A	G	16: 22,014,231	T90A	probably benign	Het
Serpinh1	C	T	7: 99,349,288	R45H	probably benign	Het
Siglecg	T	C	7: 43,409,279	V152A	probably benign	Het
Sipa1l2	T	A	8: 125,447,598	M1314L	probably benign	Het
Slc23a1	A	G	18: 35,625,949	F63S	possibly damaging	Het
Slc25a40	T	A	5: 8,442,509	L133Q	probably damaging	Het
Slc6a16	A	G	7: 45,259,347	E117G	probably damaging	Het
Tmem235	G	A	11: 117,864,207	V162M	probably benign	Het
Trank1	A	G	9: 111,392,516	T2774A	probably benign	Het
Trav10n	A	T	14: 53,122,130	H6L	probably benign	Het
Trav13d-3	G	A	14: 53,033,247	W55*	probably null	Het
Zfp654	G	T	16: 64,851,648	A2E	probably damaging	Het
Zkscan5	A	C	5: 145,220,866	H726P	probably damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGACACAGCCAGGTCTCAAC -3'
(R):5'- ATTGAACAAATGCTCAGCAGTG -3'

Sequencing Primer
(F):5'- GGTCTCAACCTTGGCATTCATC -3'
(R):5'- CTAGAATCTGACTTTGGGCCAGGAC -3'

Posted On

2019-12-20