Incidental Mutation 'R7884:Mars'
ID608958
Institutional Source Beutler Lab
Gene Symbol Mars
Ensembl Gene ENSMUSG00000040354
Gene Namemethionine-tRNA synthetase
Synonymsmethionine tRNA ligase, MetRS, methionyl-tRNA synthetase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7884 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127296221-127311786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127300245 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 525 (I525T)
Ref Sequence ENSEMBL: ENSMUSP00000037446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026475] [ENSMUST00000037290] [ENSMUST00000139091] [ENSMUST00000171564]
Predicted Effect probably benign
Transcript: ENSMUST00000026475
SMART Domains Protein: ENSMUSP00000026475
Gene: ENSMUSG00000025408

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
BRLZ 94 160 1.23e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000037290
AA Change: I525T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037446
Gene: ENSMUSG00000040354
AA Change: I525T

DomainStartEndE-ValueType
PDB:4BL7|A 1 220 1e-118 PDB
low complexity region 221 233 N/A INTRINSIC
Pfam:tRNA-synt_1g 268 660 6.8e-142 PFAM
WHEP-TRS 847 902 7.95e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134778
SMART Domains Protein: ENSMUSP00000118031
Gene: ENSMUSG00000040354

DomainStartEndE-ValueType
SCOP:d1f4la1 5 91 2e-10 SMART
WHEP-TRS 129 184 7.95e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139091
SMART Domains Protein: ENSMUSP00000118339
Gene: ENSMUSG00000025408

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
BRLZ 94 160 1.23e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171564
AA Change: I525T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130666
Gene: ENSMUSG00000040354
AA Change: I525T

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:GST_C 94 180 1e-6 PFAM
low complexity region 205 213 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
Pfam:tRNA-synt_1g 268 660 9.6e-149 PFAM
WHEP-TRS 855 910 7.95e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: The encoded protein belongs to the class I family of tRNA synthetases, a class of enzymes that charge tRNAs with their cognate amino acids. The related human gene product is essential for the translation initiation of mRNAs. This gene has an overlapping 3' UTR tail-to-tail arrangement with an adjacent gene on the opposite strand that encodes an inhibitor of the CCAAT/enhancer-binding protein's DNA binding activity. This arrangement, conserved in human and mouse, may be involved in mRNA stability and possible functional and regulatory interaction of these adjacent overlapping genes. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,602,231 T1158A probably damaging Het
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 Y172F probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Dnah7c C T 1: 46,791,769 L3813F probably benign Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Etnk2 T C 1: 133,365,700 V127A possibly damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
Gnb3 T C 6: 124,837,092 T178A probably benign Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Miga2 T A 2: 30,371,204 D170E probably benign Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nr2f1 G A 13: 78,189,869 T376I probably benign Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Omd A G 13: 49,590,154 M227V probably damaging Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Pou2f2 T C 7: 25,116,064 M93V probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Sipa1l2 T A 8: 125,447,598 M1314L probably benign Het
Slc23a1 A G 18: 35,625,949 F63S possibly damaging Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Mars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Mars APN 10 127298006 missense probably benign 0.31
IGL00813:Mars APN 10 127300047 missense probably damaging 1.00
IGL01292:Mars APN 10 127305518 missense probably damaging 1.00
IGL01718:Mars APN 10 127305838 missense possibly damaging 0.95
IGL02505:Mars APN 10 127304244 nonsense probably null
IGL02986:Mars APN 10 127297569 missense probably benign 0.09
PIT4366001:Mars UTSW 10 127299398 missense possibly damaging 0.72
R0149:Mars UTSW 10 127300034 missense probably damaging 1.00
R1445:Mars UTSW 10 127297988 missense possibly damaging 0.75
R1702:Mars UTSW 10 127310079 missense possibly damaging 0.52
R1998:Mars UTSW 10 127300478 nonsense probably null
R1998:Mars UTSW 10 127302871 missense probably benign
R2089:Mars UTSW 10 127299285 missense probably damaging 1.00
R2091:Mars UTSW 10 127299285 missense probably damaging 1.00
R2091:Mars UTSW 10 127299285 missense probably damaging 1.00
R4597:Mars UTSW 10 127300453 missense probably damaging 1.00
R4809:Mars UTSW 10 127300215 missense probably damaging 1.00
R4923:Mars UTSW 10 127296680 unclassified probably benign
R5563:Mars UTSW 10 127308661 missense probably benign
R5890:Mars UTSW 10 127298045 missense probably benign 0.04
R5895:Mars UTSW 10 127296549 missense probably benign 0.01
R5986:Mars UTSW 10 127304302 nonsense probably null
R6300:Mars UTSW 10 127296560 missense probably benign 0.00
R7267:Mars UTSW 10 127308586 missense probably benign
R7544:Mars UTSW 10 127311610 missense probably benign 0.24
R7573:Mars UTSW 10 127302810 critical splice donor site probably null
R7740:Mars UTSW 10 127300575 missense probably benign 0.16
R8286:Mars UTSW 10 127305479 missense probably benign 0.35
R8397:Mars UTSW 10 127300499 missense possibly damaging 0.48
X0027:Mars UTSW 10 127308349 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCACCTAGGAGAAGATATTGGG -3'
(R):5'- ACCAGAGACCTCAAATGGGG -3'

Sequencing Primer
(F):5'- ATTGGGAGATTGCCTGAAACTCTCC -3'
(R):5'- CTCAAATGGGGAACGCCTGTG -3'
Posted On2019-12-20