Incidental Mutation 'R7884:Omd'
ID608964
Institutional Source Beutler Lab
Gene Symbol Omd
Ensembl Gene ENSMUSG00000048368
Gene Nameosteomodulin
Synonymsosteoadherin, OSAD, SLRR2C
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7884 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location49582462-49592822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49590154 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 227 (M227V)
Ref Sequence ENSEMBL: ENSMUSP00000065706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000065494] [ENSMUST00000221170]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065494
AA Change: M227V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065706
Gene: ENSMUSG00000048368
AA Change: M227V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 61 95 3.14e-11 SMART
LRR 115 139 2.15e2 SMART
LRR 140 160 2.2e1 SMART
LRR 162 184 4.21e1 SMART
LRR 185 210 1.01e2 SMART
LRR 211 234 6.96e0 SMART
LRR 235 255 8.49e1 SMART
LRR 256 279 1.76e-1 SMART
LRR 300 322 7.8e1 SMART
Blast:LRR 330 353 6e-8 BLAST
low complexity region 385 391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221170
AA Change: M227V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired cued contextual conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,602,231 T1158A probably damaging Het
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 Y172F probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Dnah7c C T 1: 46,791,769 L3813F probably benign Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Etnk2 T C 1: 133,365,700 V127A possibly damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
Gnb3 T C 6: 124,837,092 T178A probably benign Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Mars A G 10: 127,300,245 I525T probably damaging Het
Miga2 T A 2: 30,371,204 D170E probably benign Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nr2f1 G A 13: 78,189,869 T376I probably benign Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Pou2f2 T C 7: 25,116,064 M93V probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Sipa1l2 T A 8: 125,447,598 M1314L probably benign Het
Slc23a1 A G 18: 35,625,949 F63S possibly damaging Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Omd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Omd APN 13 49589643 nonsense probably null
IGL01982:Omd APN 13 49589497 missense possibly damaging 0.88
IGL02678:Omd APN 13 49592281 missense probably benign 0.37
IGL03069:Omd APN 13 49592394 utr 3 prime probably benign
R1036:Omd UTSW 13 49589971 missense probably damaging 1.00
R3954:Omd UTSW 13 49589737 missense probably benign 0.00
R4030:Omd UTSW 13 49589649 missense probably benign 0.08
R4335:Omd UTSW 13 49590236 missense probably benign 0.02
R5095:Omd UTSW 13 49589698 missense possibly damaging 0.95
R5137:Omd UTSW 13 49590076 missense probably benign 0.05
R5400:Omd UTSW 13 49592227 missense probably benign 0.37
R5596:Omd UTSW 13 49592338 missense probably benign 0.16
R5930:Omd UTSW 13 49589636 missense possibly damaging 0.63
R6132:Omd UTSW 13 49590367 missense probably damaging 0.97
R6294:Omd UTSW 13 49589991 missense probably damaging 1.00
R6454:Omd UTSW 13 49589869 missense probably damaging 0.99
R6680:Omd UTSW 13 49589528 missense possibly damaging 0.74
R6704:Omd UTSW 13 49589873 missense probably damaging 1.00
R6932:Omd UTSW 13 49590234 missense probably damaging 1.00
R7427:Omd UTSW 13 49592269 missense possibly damaging 0.68
R7971:Omd UTSW 13 49590254 missense probably benign 0.00
R8129:Omd UTSW 13 49592089 missense probably damaging 0.99
R8399:Omd UTSW 13 49589869 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCTTTGGAAAGACTCCTTCTTGG -3'
(R):5'- TGGAATGTAGAATGCTTGCTTC -3'

Sequencing Primer
(F):5'- GGAAAGACTCCTTCTTGGTTATAATG -3'
(R):5'- GTGTCCAACGTTGAGTTCTATAAG -3'
Posted On2019-12-20