Incidental Mutation 'R7884:Nr2f1'
ID608966
Institutional Source Beutler Lab
Gene Symbol Nr2f1
Ensembl Gene ENSMUSG00000069171
Gene Namenuclear receptor subfamily 2, group F, member 1
SynonymsErbal3, COUP-TF1, Tcfcoup1, COUP-TFI
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7884 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location78188973-78199757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78189869 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 376 (T376I)
Ref Sequence ENSEMBL: ENSMUSP00000089036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091458] [ENSMUST00000125176] [ENSMUST00000127137] [ENSMUST00000150498]
Predicted Effect probably benign
Transcript: ENSMUST00000091458
AA Change: T376I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000089036
Gene: ENSMUSG00000069171
AA Change: T376I

DomainStartEndE-ValueType
low complexity region 16 65 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
ZnF_C4 80 151 3.01e-39 SMART
HOLI 218 378 5.16e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125176
AA Change: T229I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000122618
Gene: ENSMUSG00000069171
AA Change: T229I

DomainStartEndE-ValueType
HOLI 71 231 5.16e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127137
AA Change: T219I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000133704
Gene: ENSMUSG00000069171
AA Change: T219I

DomainStartEndE-ValueType
HOLI 61 221 5.16e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150498
AA Change: T219I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000118161
Gene: ENSMUSG00000069171
AA Change: T219I

DomainStartEndE-ValueType
HOLI 61 221 5.16e-47 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor and transcriptional regulator. The encoded protein acts as a homodimer and binds to 5'-AGGTCA-3' repeats. Defects in this gene are a cause of Bosch-Boonstra optic atrophy syndrome (BBOAS). [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for a null allele die perinatally with axon guidance defects in all forebrain commissures. Homozygotes for another null allele show neonatal death, impaired cranial ganglion IX formation and axon guidance, increased cochlear HC and support cell number, and altered cortex regionalization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,602,231 T1158A probably damaging Het
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 Y172F probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Dnah7c C T 1: 46,791,769 L3813F probably benign Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Etnk2 T C 1: 133,365,700 V127A possibly damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
Gnb3 T C 6: 124,837,092 T178A probably benign Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Mars A G 10: 127,300,245 I525T probably damaging Het
Miga2 T A 2: 30,371,204 D170E probably benign Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Omd A G 13: 49,590,154 M227V probably damaging Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Pou2f2 T C 7: 25,116,064 M93V probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Sipa1l2 T A 8: 125,447,598 M1314L probably benign Het
Slc23a1 A G 18: 35,625,949 F63S possibly damaging Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Nr2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Nr2f1 APN 13 78189833 missense probably damaging 1.00
IGL00553:Nr2f1 APN 13 78198242 missense probably damaging 1.00
IGL00821:Nr2f1 APN 13 78198114 unclassified probably benign
IGL02346:Nr2f1 APN 13 78195408 missense probably damaging 1.00
IGL02586:Nr2f1 APN 13 78195156 unclassified probably benign
IGL02587:Nr2f1 APN 13 78195156 unclassified probably benign
IGL02588:Nr2f1 APN 13 78195156 unclassified probably benign
R1470:Nr2f1 UTSW 13 78198165 missense possibly damaging 0.94
R1470:Nr2f1 UTSW 13 78198165 missense possibly damaging 0.94
R1865:Nr2f1 UTSW 13 78189926 missense probably damaging 1.00
R1959:Nr2f1 UTSW 13 78189816 missense probably damaging 1.00
R2284:Nr2f1 UTSW 13 78195462 missense probably damaging 1.00
R3861:Nr2f1 UTSW 13 78195675 nonsense probably null
R4542:Nr2f1 UTSW 13 78189821 missense probably damaging 1.00
R6248:Nr2f1 UTSW 13 78196492 intron probably benign
R6285:Nr2f1 UTSW 13 78195663 missense probably benign 0.01
R7305:Nr2f1 UTSW 13 78195179 missense probably damaging 1.00
R7496:Nr2f1 UTSW 13 78195242 missense probably damaging 1.00
R7653:Nr2f1 UTSW 13 78195597 missense probably benign 0.32
R7954:Nr2f1 UTSW 13 78189994 missense probably damaging 1.00
R8030:Nr2f1 UTSW 13 78195446 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TGGTCAGGGAGAGTCCTCTTAG -3'
(R):5'- ATGGTGTGTATGCCTTTCCATC -3'

Sequencing Primer
(F):5'- CAGGGAGAGTCCTCTTAGTCTCTAG -3'
(R):5'- ATCTCACTCACCTAACAATCTGTC -3'
Posted On2019-12-20