Incidental Mutation 'R7884:Arhgap31'
ID608971
Institutional Source Beutler Lab
Gene Symbol Arhgap31
Ensembl Gene ENSMUSG00000022799
Gene NameRho GTPase activating protein 31
SynonymsCdGAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R7884 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location38598340-38713274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38602231 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1158 (T1158A)
Ref Sequence ENSEMBL: ENSMUSP00000023487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023487]
Predicted Effect probably damaging
Transcript: ENSMUST00000023487
AA Change: T1158A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023487
Gene: ENSMUSG00000022799
AA Change: T1158A

DomainStartEndE-ValueType
RhoGAP 32 213 1.04e-60 SMART
low complexity region 291 303 N/A INTRINSIC
low complexity region 503 522 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 722 733 N/A INTRINSIC
low complexity region 766 786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP). A variety of cellular processes are regulated by Rho GTPases which cycle between an inactive form bound to GDP and an active form bound to GTP. This cycling between inactive and active forms is regulated by guanine nucleotide exchange factors and GAPs. The encoded protein is a GAP shown to regulate two GTPases involved in protein trafficking and cell growth. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 Y172F probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Dnah7c C T 1: 46,791,769 L3813F probably benign Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Etnk2 T C 1: 133,365,700 V127A possibly damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
Gnb3 T C 6: 124,837,092 T178A probably benign Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Mars A G 10: 127,300,245 I525T probably damaging Het
Miga2 T A 2: 30,371,204 D170E probably benign Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nr2f1 G A 13: 78,189,869 T376I probably benign Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Omd A G 13: 49,590,154 M227V probably damaging Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Pou2f2 T C 7: 25,116,064 M93V probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Sipa1l2 T A 8: 125,447,598 M1314L probably benign Het
Slc23a1 A G 18: 35,625,949 F63S possibly damaging Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Arhgap31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00741:Arhgap31 APN 16 38603001 missense probably damaging 1.00
IGL01062:Arhgap31 APN 16 38601456 missense probably damaging 1.00
IGL01152:Arhgap31 APN 16 38602239 missense possibly damaging 0.49
IGL01680:Arhgap31 APN 16 38603614 missense probably benign 0.04
IGL01739:Arhgap31 APN 16 38603431 missense probably benign
IGL01870:Arhgap31 APN 16 38618242 missense probably damaging 1.00
IGL01936:Arhgap31 APN 16 38602925 missense probably damaging 1.00
IGL01981:Arhgap31 APN 16 38601573 missense probably damaging 1.00
IGL01983:Arhgap31 APN 16 38601765 missense probably damaging 1.00
IGL02157:Arhgap31 APN 16 38623901 missense probably damaging 1.00
IGL02629:Arhgap31 APN 16 38609164 missense probably benign 0.00
IGL03375:Arhgap31 APN 16 38602828 missense probably damaging 1.00
PIT4283001:Arhgap31 UTSW 16 38608992 missense probably damaging 1.00
R0271:Arhgap31 UTSW 16 38602510 missense possibly damaging 0.61
R1325:Arhgap31 UTSW 16 38602942 missense probably benign 0.00
R1753:Arhgap31 UTSW 16 38601612 missense possibly damaging 0.92
R1766:Arhgap31 UTSW 16 38625590 missense probably damaging 1.00
R1834:Arhgap31 UTSW 16 38603703 missense probably benign 0.02
R2104:Arhgap31 UTSW 16 38625579 missense probably benign 0.03
R2261:Arhgap31 UTSW 16 38609277 missense probably damaging 1.00
R3011:Arhgap31 UTSW 16 38601907 missense possibly damaging 0.58
R3712:Arhgap31 UTSW 16 38602533 missense possibly damaging 0.91
R3757:Arhgap31 UTSW 16 38637000 missense probably damaging 1.00
R3953:Arhgap31 UTSW 16 38603464 missense probably benign 0.00
R4105:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4107:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4108:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4109:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4198:Arhgap31 UTSW 16 38623913 missense probably damaging 1.00
R4200:Arhgap31 UTSW 16 38623913 missense probably damaging 1.00
R4273:Arhgap31 UTSW 16 38602335 missense possibly damaging 0.92
R5020:Arhgap31 UTSW 16 38603076 missense probably damaging 1.00
R5100:Arhgap31 UTSW 16 38601459 missense probably damaging 1.00
R6516:Arhgap31 UTSW 16 38609404 missense possibly damaging 0.47
R6879:Arhgap31 UTSW 16 38602314 missense probably benign
R7341:Arhgap31 UTSW 16 38712514 splice site probably null
R7880:Arhgap31 UTSW 16 38602725 missense probably benign 0.37
R8156:Arhgap31 UTSW 16 38625629 missense probably damaging 1.00
R8223:Arhgap31 UTSW 16 38603722 missense probably benign 0.21
R8413:Arhgap31 UTSW 16 38602921 missense possibly damaging 0.76
X0063:Arhgap31 UTSW 16 38602398 missense probably damaging 0.99
Z1176:Arhgap31 UTSW 16 38623893 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GATCTCAGGGGTTGAACCAG -3'
(R):5'- TGAGTGTGGGCCCTCAAAAG -3'

Sequencing Primer
(F):5'- CAGGGGTTGAACCAGGTTCTTC -3'
(R):5'- AGGGAAACACAGGCCGTCTTC -3'
Posted On2019-12-20