Incidental Mutation 'R0152:Rims4'
ID60898
Institutional Source Beutler Lab
Gene Symbol Rims4
Ensembl Gene ENSMUSG00000035226
Gene Nameregulating synaptic membrane exocytosis 4
SynonymsRim4
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R0152 (G1)
Quality Score92
Status Not validated
Chromosome2
Chromosomal Location163859751-163918683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 163863929 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 262 (V262M)
Ref Sequence ENSEMBL: ENSMUSP00000045637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044734] [ENSMUST00000044798] [ENSMUST00000109396]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044734
AA Change: V262M

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045637
Gene: ENSMUSG00000035226
AA Change: V262M

DomainStartEndE-ValueType
C2 129 232 1.42e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044798
SMART Domains Protein: ENSMUSP00000048326
Gene: ENSMUSG00000035238

DomainStartEndE-ValueType
Pfam:Ion_trans_2 78 153 1.2e-20 PFAM
Pfam:Ion_trans_2 184 267 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109396
SMART Domains Protein: ENSMUSP00000105023
Gene: ENSMUSG00000035238

DomainStartEndE-ValueType
Pfam:Ion_trans_2 62 134 5.2e-21 PFAM
Pfam:Ion_trans_2 165 248 1.6e-17 PFAM
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induec allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Rims4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Rims4 APN 2 163864102 missense probably damaging 1.00
IGL01980:Rims4 APN 2 163865782 splice site probably benign
demure UTSW 2 163864120 missense probably damaging 0.99
diminutive UTSW 2 163864865 critical splice donor site probably null
R0115:Rims4 UTSW 2 163864120 missense probably damaging 0.99
R0153:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0173:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0238:Rims4 UTSW 2 163864025 missense probably benign 0.03
R0238:Rims4 UTSW 2 163864025 missense probably benign 0.03
R0481:Rims4 UTSW 2 163864120 missense probably damaging 0.99
R0702:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0735:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0973:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0973:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0974:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1013:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1014:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1017:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1104:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1209:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1401:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1554:Rims4 UTSW 2 163879122 missense probably damaging 1.00
R1618:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R2104:Rims4 UTSW 2 163864865 critical splice donor site probably null
R2171:Rims4 UTSW 2 163864126 splice site probably null
R3611:Rims4 UTSW 2 163879206 missense possibly damaging 0.50
R3735:Rims4 UTSW 2 163863985 missense possibly damaging 0.88
R3836:Rims4 UTSW 2 163918653 missense possibly damaging 0.86
R4685:Rims4 UTSW 2 163864994 nonsense probably null
R4849:Rims4 UTSW 2 163865543 missense probably benign 0.11
R4873:Rims4 UTSW 2 163865523 missense probably null 0.00
R4875:Rims4 UTSW 2 163865523 missense probably null 0.00
R5337:Rims4 UTSW 2 163865843 missense probably benign 0.00
R5415:Rims4 UTSW 2 163918676 missense probably benign 0.26
R5646:Rims4 UTSW 2 163864017 nonsense probably null
R6487:Rims4 UTSW 2 163864897 missense possibly damaging 0.93
R7213:Rims4 UTSW 2 163864061 missense probably benign 0.00
R7814:Rims4 UTSW 2 163918628 missense probably benign 0.05
R7849:Rims4 UTSW 2 163864054 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTAGCCAACCCACTGGGAAAG -3'
(R):5'- TCAGTTGCAAGACGTAACCAGCC -3'

Sequencing Primer
(F):5'- CCACTGGGAAAGGGAAGGTC -3'
(R):5'- CGTGTGGGGAAACTACGG -3'
Posted On2013-07-24