Incidental Mutation 'R7884:Slc23a1'
ID608980
Institutional Source Beutler Lab
Gene Symbol Slc23a1
Ensembl Gene ENSMUSG00000024354
Gene Namesolute carrier family 23 (nucleobase transporters), member 1
SynonymsSlc23a2, YSPL3, D18Ucla2, SVCT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R7884 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location35614604-35627244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35625949 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 63 (F63S)
Ref Sequence ENSEMBL: ENSMUSP00000025212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025212] [ENSMUST00000150877]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025212
AA Change: F63S

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025212
Gene: ENSMUSG00000024354
AA Change: F63S

DomainStartEndE-ValueType
Pfam:Xan_ur_permease 50 484 4.9e-91 PFAM
transmembrane domain 496 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150877
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The absorption of vitamin C into the body and its distribution to organs requires two sodium-dependent vitamin C transporters. This gene encodes one of the two transporters. The encoded protein is active in bulk vitamin C transport involving epithelial surfaces. Previously, this gene had an official symbol of SLC23A2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal ascorbate homeostasis and early postnatal lethality associated with lethargy and lack of gastric milk. Heterozygous mice of homozgous dams exhibit a similar phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 T C 16: 38,602,231 T1158A probably damaging Het
Arhgap32 A G 9: 32,260,514 E1530G possibly damaging Het
BC005561 T C 5: 104,521,346 S1245P possibly damaging Het
C3 A G 17: 57,226,264 F113S probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Csmd1 T C 8: 15,961,418 N2545S probably damaging Het
Ctsh A G 9: 90,061,423 D49G probably benign Het
Cyp7a1 T A 4: 6,272,697 Y172F probably benign Het
Ddx52 A G 11: 83,952,085 probably null Het
Dmxl1 A G 18: 49,893,407 T1861A possibly damaging Het
Dnah7c C T 1: 46,791,769 L3813F probably benign Het
Efl1 A G 7: 82,658,099 I68V probably damaging Het
Etnk2 T C 1: 133,365,700 V127A possibly damaging Het
Fank1 G C 7: 133,876,825 R206P probably damaging Het
Fbxw27 G A 9: 109,789,400 R73* probably null Het
Fndc1 A T 17: 7,773,197 S556T unknown Het
Gnb3 T C 6: 124,837,092 T178A probably benign Het
H2-M10.3 A T 17: 36,366,282 L326Q probably benign Het
Hist1h2bk T C 13: 22,036,055 S57P probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itfg2 T C 6: 128,416,381 probably benign Het
Kcnma1 G A 14: 23,336,989 P995L probably benign Het
Lama1 G A 17: 67,769,435 G1068D Het
Lats1 A T 10: 7,697,526 K125* probably null Het
Lipg C T 18: 74,948,007 M334I probably damaging Het
Loxhd1 A T 18: 77,431,213 E1905V probably damaging Het
Lpin1 C T 12: 16,562,369 G544D Het
Lrrc29 A G 8: 105,315,533 I221T probably benign Het
Lyst A T 13: 13,707,683 N2853I probably benign Het
Mars A G 10: 127,300,245 I525T probably damaging Het
Miga2 T A 2: 30,371,204 D170E probably benign Het
Mrpl34 T C 8: 71,465,267 V28A probably benign Het
Muc16 A T 9: 18,642,694 V4101E unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo1f A G 17: 33,598,296 Y771C probably damaging Het
Nr2f1 G A 13: 78,189,869 T376I probably benign Het
Nsd1 A G 13: 55,313,255 T2535A probably damaging Het
Nup98 T A 7: 102,176,349 T428S probably benign Het
Omd A G 13: 49,590,154 M227V probably damaging Het
Osbpl7 A C 11: 97,060,457 I657L possibly damaging Het
Pdgfrb T C 18: 61,072,658 V572A probably damaging Het
Pik3c3 T C 18: 30,312,571 V537A probably benign Het
Pou2f2 T C 7: 25,116,064 M93V probably benign Het
Ppip5k2 T C 1: 97,740,482 T640A probably benign Het
Ptar1 C T 19: 23,708,794 P157S probably benign Het
Rapgef2 T A 3: 79,066,626 D1471V possibly damaging Het
Rgs7 A T 1: 175,149,650 probably null Het
Rhag A G 17: 40,831,645 Y247C probably benign Het
Sardh A G 2: 27,239,371 I305T probably damaging Het
Scn11a A G 9: 119,804,551 I372T probably benign Het
Scn3a G T 2: 65,536,515 D54E probably damaging Het
Senp2 A G 16: 22,014,231 T90A probably benign Het
Serpinh1 C T 7: 99,349,288 R45H probably benign Het
Siglecg T C 7: 43,409,279 V152A probably benign Het
Sipa1l2 T A 8: 125,447,598 M1314L probably benign Het
Slc25a40 T A 5: 8,442,509 L133Q probably damaging Het
Slc6a16 A G 7: 45,259,347 E117G probably damaging Het
Tmem235 G A 11: 117,864,207 V162M probably benign Het
Trank1 A G 9: 111,392,516 T2774A probably benign Het
Trav10n A T 14: 53,122,130 H6L probably benign Het
Trav13d-3 G A 14: 53,033,247 W55* probably null Het
Zfp654 G T 16: 64,851,648 A2E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Slc23a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Slc23a1 APN 18 35624203 missense probably damaging 1.00
IGL01969:Slc23a1 APN 18 35624754 missense possibly damaging 0.93
R0360:Slc23a1 UTSW 18 35622979 splice site probably benign
R1296:Slc23a1 UTSW 18 35622623 missense possibly damaging 0.88
R1720:Slc23a1 UTSW 18 35625851 missense possibly damaging 0.95
R2107:Slc23a1 UTSW 18 35625826 missense possibly damaging 0.89
R2140:Slc23a1 UTSW 18 35626434 missense unknown
R4694:Slc23a1 UTSW 18 35619580 missense probably damaging 0.99
R5298:Slc23a1 UTSW 18 35622510 critical splice donor site probably null
R5593:Slc23a1 UTSW 18 35622296 missense probably damaging 1.00
R5629:Slc23a1 UTSW 18 35626492 missense probably benign 0.00
R5842:Slc23a1 UTSW 18 35622882 missense probably damaging 0.99
R6229:Slc23a1 UTSW 18 35619524 missense probably benign 0.08
R6233:Slc23a1 UTSW 18 35624444 missense probably damaging 1.00
R6268:Slc23a1 UTSW 18 35619571 missense probably damaging 1.00
R6552:Slc23a1 UTSW 18 35622338 missense probably damaging 1.00
R6966:Slc23a1 UTSW 18 35625061 missense probably damaging 1.00
R7070:Slc23a1 UTSW 18 35621781 missense probably damaging 1.00
R7586:Slc23a1 UTSW 18 35625838 missense probably damaging 0.99
R7849:Slc23a1 UTSW 18 35624501 missense probably benign 0.00
R8322:Slc23a1 UTSW 18 35622535 missense probably damaging 1.00
R8324:Slc23a1 UTSW 18 35622535 missense probably damaging 1.00
R8341:Slc23a1 UTSW 18 35622535 missense probably damaging 1.00
R8342:Slc23a1 UTSW 18 35622535 missense probably damaging 1.00
R8444:Slc23a1 UTSW 18 35624436 missense possibly damaging 0.95
X0065:Slc23a1 UTSW 18 35626359 missense unknown
Z1088:Slc23a1 UTSW 18 35624508 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGCATGCGAGTATGTGTGC -3'
(R):5'- CCAAAGAAGGTTAAGTGGCCTG -3'

Sequencing Primer
(F):5'- CATGCGAGTATGTGTGCTTGGG -3'
(R):5'- TTGTGGGTAGCATATGATAGACAG -3'
Posted On2019-12-20