Incidental Mutation 'R7885:Gpatch2'
ID608987
Institutional Source Beutler Lab
Gene Symbol Gpatch2
Ensembl Gene ENSMUSG00000039210
Gene NameG patch domain containing 2
Synonyms5830433G22Rik, Gpatc2, 5830436K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7885 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location187215508-187351704 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 187225501 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000065009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044812] [ENSMUST00000065573] [ENSMUST00000110943] [ENSMUST00000159748] [ENSMUST00000160471] [ENSMUST00000160481] [ENSMUST00000160570]
Predicted Effect probably null
Transcript: ENSMUST00000044812
SMART Domains Protein: ENSMUSP00000048979
Gene: ENSMUSG00000039210

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000065573
SMART Domains Protein: ENSMUSP00000065009
Gene: ENSMUSG00000039210

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
G_patch 464 510 3.95e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110943
SMART Domains Protein: ENSMUSP00000106568
Gene: ENSMUSG00000039210

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
G_patch 427 473 3.95e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159748
SMART Domains Protein: ENSMUSP00000137858
Gene: ENSMUSG00000039210

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160471
SMART Domains Protein: ENSMUSP00000124407
Gene: ENSMUSG00000039210

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 84 95 N/A INTRINSIC
low complexity region 132 142 N/A INTRINSIC
low complexity region 182 191 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
G_patch 441 487 3.95e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160481
SMART Domains Protein: ENSMUSP00000137801
Gene: ENSMUSG00000039210

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160570
SMART Domains Protein: ENSMUSP00000125750
Gene: ENSMUSG00000039210

DomainStartEndE-ValueType
G_patch 133 179 3.95e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. The encoded protein contains a G-patch domain with an RNA binding motif. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo TCTAT TCTATACTAT 5: 14,714,191 probably null Het
Pclo T TTCTAG 5: 14,714,195 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Pstpip2 C A 18: 77,794,722 T2K probably benign Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Gpatch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Gpatch2 APN 1 187230794 missense probably damaging 1.00
IGL02324:Gpatch2 APN 1 187225739 missense probably damaging 1.00
IGL02493:Gpatch2 APN 1 187233128 splice site probably benign
IGL02583:Gpatch2 APN 1 187233317 splice site probably null
IGL02583:Gpatch2 APN 1 187233318 splice site probably null
IGL02632:Gpatch2 APN 1 187225981 missense probably damaging 1.00
R0100:Gpatch2 UTSW 1 187225817 missense probably damaging 1.00
R1801:Gpatch2 UTSW 1 187225831 missense probably benign 0.03
R1966:Gpatch2 UTSW 1 187322301 missense probably damaging 1.00
R3870:Gpatch2 UTSW 1 187322294 missense probably damaging 1.00
R4028:Gpatch2 UTSW 1 187226140 missense possibly damaging 0.53
R4471:Gpatch2 UTSW 1 187233140 missense probably damaging 1.00
R5346:Gpatch2 UTSW 1 187225868 missense probably benign 0.00
R6338:Gpatch2 UTSW 1 187225514 missense probably damaging 0.99
R6936:Gpatch2 UTSW 1 187233236 missense probably benign 0.04
R7185:Gpatch2 UTSW 1 187226197 missense probably damaging 1.00
R7708:Gpatch2 UTSW 1 187232766 missense probably benign
R8508:Gpatch2 UTSW 1 187304355 missense probably benign 0.04
Z1177:Gpatch2 UTSW 1 187225691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAATCAGATTGAAGCTGTCATCC -3'
(R):5'- ATCAGAGCCTTCACTTAAGCAG -3'

Sequencing Primer
(F):5'- GAAGCTGTCATCCTTTGAATAGTTC -3'
(R):5'- TGAACATTGTAGGATCTCCGC -3'
Posted On2019-12-20