Incidental Mutation 'R0152:Snapc1'
ID60899
Institutional Source Beutler Lab
Gene Symbol Snapc1
Ensembl Gene ENSMUSG00000021113
Gene Namesmall nuclear RNA activating complex, polypeptide 1
Synonyms2700033G17Rik
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0152 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location73964481-73988966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73975032 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 81 (R81C)
Ref Sequence ENSEMBL: ENSMUSP00000152248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021532] [ENSMUST00000220882] [ENSMUST00000221556]
Predicted Effect probably damaging
Transcript: ENSMUST00000021532
AA Change: R302C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021532
Gene: ENSMUSG00000021113
AA Change: R302C

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:SNAPc_SNAP43 26 210 4.5e-65 PFAM
low complexity region 261 273 N/A INTRINSIC
low complexity region 307 316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220882
AA Change: R81C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000220909
AA Change: R48C
Predicted Effect probably benign
Transcript: ENSMUST00000221556
Meta Mutation Damage Score 0.2723 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Snapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Snapc1 APN 12 73968374 splice site probably null
IGL00529:Snapc1 APN 12 73964655 missense probably benign 0.00
IGL00676:Snapc1 APN 12 73971913 missense probably damaging 1.00
IGL01373:Snapc1 APN 12 73964680 missense probably benign 0.00
IGL02060:Snapc1 APN 12 73968036 missense probably damaging 1.00
IGL02309:Snapc1 APN 12 73968027 missense probably damaging 1.00
IGL02653:Snapc1 APN 12 73982487 missense probably benign 0.00
IGL02686:Snapc1 APN 12 73964596 intron probably benign
IGL03160:Snapc1 APN 12 73970204 missense probably damaging 1.00
PIT4362001:Snapc1 UTSW 12 73982495 missense probably damaging 0.98
R0056:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0113:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0153:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0244:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0245:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0316:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0318:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0352:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0646:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0841:Snapc1 UTSW 12 73975006 splice site probably benign
R2188:Snapc1 UTSW 12 73970227 missense probably damaging 1.00
R2483:Snapc1 UTSW 12 73964643 missense probably benign 0.02
R4165:Snapc1 UTSW 12 73982580 critical splice donor site probably null
R4169:Snapc1 UTSW 12 73982491 missense probably benign 0.00
R4549:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4550:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4658:Snapc1 UTSW 12 73983868 missense possibly damaging 0.75
R6976:Snapc1 UTSW 12 73970200 missense probably damaging 1.00
R7432:Snapc1 UTSW 12 73968294 missense probably benign 0.01
R7488:Snapc1 UTSW 12 73982511 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CAGGAATCTGGCGGTACAGTTACG -3'
(R):5'- AGGGTCTCTTTCAGCAACAAGAGC -3'

Sequencing Primer
(F):5'- GCTCTGTCCTCAGACCATTT -3'
(R):5'- taccccccaaccaaccc -3'
Posted On2013-07-24