Mutagenetix > Incidental Mutations

Incidental Mutation 'R7885:Asic5'

608991

Institutional Source

Beutler Lab

Gene Symbol

Asic5

Ensembl Gene

ENSMUSG00000028008

Gene Name

acid-sensing (proton-gated) ion channel family member 5

Synonyms

BLINaC, Accn5, brain-liver-intestine amiloride-sensitive sodium channel

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7885 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81982290-82021233 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 82006505 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 204 (Y204F)

Ref Sequence

ENSEMBL: ENSMUSP00000029641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029641] [ENSMUST00000107736]

Predicted Effect

probably benign
Transcript: ENSMUST00000029641
AA Change: Y204F

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000029641
Gene: ENSMUSG00000028008
AA Change: Y204F

Domain	Start	End	E-Value	Type
Pfam:ASC	41	466	3.5e-94	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107736
AA Change: Y162F

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000103364
Gene: ENSMUSG00000028008
AA Change: Y162F

Domain	Start	End	E-Value	Type
Pfam:ASC	1	425	5.5e-110	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the amiloride-sensitive Na+ channel and degenerin (NaC/DEG) family, members of which have been identified in many animal species ranging from the nematode to human. The amiloride-sensitive Na(+) channel encoded by this gene is primarily expressed in the small intestine, however, its exact function is not known. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,189,314	L608P	probably damaging	Het
Adarb1	A	G	10: 77,295,708	V649A	possibly damaging	Het
Arglu1	C	T	8: 8,667,337	R244H	possibly damaging	Het
Asz1	A	G	6: 18,104,877	F76S	probably damaging	Het
Bin1	G	A	18: 32,419,843	A174T	probably damaging	Het
Bnipl	A	C	3: 95,250,240	S23A	probably benign	Het
Cd19	T	C	7: 126,412,131	T294A	probably benign	Het
Cdon	G	A	9: 35,456,522	V238I	probably benign	Het
Chd3	A	T	11: 69,356,625	D957E	probably benign	Het
Crhbp	T	C	13: 95,432,007	Q307R	probably damaging	Het
Cst3	A	G	2: 148,872,821	M112T	probably benign	Het
Dgkb	A	G	12: 38,139,426	E276G	probably damaging	Het
Exoc4	T	A	6: 33,758,066	N539K	probably benign	Het
Gm3099	A	G	14: 3,999,461	E85G	probably benign	Het
Gpatch2	A	G	1: 187,225,501		probably null	Het
Hs3st5	T	A	10: 36,828,780	Y26*	probably null	Het
Hspg2	A	T	4: 137,516,837	D802V	probably damaging	Het
Ifih1	A	G	2: 62,601,469	V846A	possibly damaging	Het
Lama4	T	A	10: 39,088,844	S1402T	probably benign	Het
Lrmda	A	G	14: 22,598,320	T73A	unknown	Het
Lrrc1	A	T	9: 77,442,189	V365E	probably damaging	Het
Lrrc37a	T	A	11: 103,503,042	Q519L	probably benign	Het
Mlc1	G	T	15: 88,977,904	D36E	probably benign	Het
Mrc2	A	T	11: 105,332,266	D445V	probably damaging	Het
Muc16	A	G	9: 18,639,464	S5178P	probably benign	Het
Nbea	A	G	3: 55,665,689	I2491T	probably damaging	Het
Ncoa1	A	G	12: 4,339,044	I77T	probably damaging	Het
Npepps	G	T	11: 97,218,648	H701N	probably damaging	Het
Olfr733	T	G	14: 50,298,584	T242P	probably damaging	Het
Olfr837	A	T	9: 19,137,535	I181F	possibly damaging	Het
Pclo	GTCTAT	GTCTATTCTAT	5: 14,714,190		probably null	Het
Pclo	TCTAT	TCTATACTAT	5: 14,714,191		probably null	Het
Pclo	T	TTCTAG	5: 14,714,195		probably null	Het
Pi4kb	T	C	3: 94,999,076	Y645H	probably damaging	Het
Pik3r5	C	T	11: 68,492,702	A449V	possibly damaging	Het
Plat	A	G	8: 22,771,720	T45A	probably benign	Het
Platr25	T	C	13: 62,700,862	K62R	possibly damaging	Het
Ppp5c	A	G	7: 17,006,186	V410A	possibly damaging	Het
Prdm2	C	T	4: 143,134,570	A717T	probably benign	Het
Pstpip2	C	A	18: 77,794,722	T2K	probably benign	Het
Ptpn12	A	C	5: 20,998,525	S418R	possibly damaging	Het
Rint1	A	G	5: 23,805,644	S255G	probably benign	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Stab2	T	C	10: 86,878,912	H1581R	probably benign	Het
Stau2	T	C	1: 16,460,353	Y114C	unknown	Het
Ticam1	T	C	17: 56,271,067	T343A	probably benign	Het
Tmem131l	T	C	3: 83,910,417	K1259E	possibly damaging	Het
Vmn2r103	T	A	17: 19,793,123	F169I	probably benign	Het
Vps33a	T	C	5: 123,535,249	K425E	possibly damaging	Het
Vwa8	T	C	14: 79,020,649	M746T	probably benign	Het
Zc3hav1	A	G	6: 38,336,663	I149T	possibly damaging	Het
Zfp708	A	T	13: 67,074,129	D62E	probably benign	Het

Other mutations in Asic5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00977:Asic5	APN	3	82004646	missense	possibly damaging	0.48
IGL01155:Asic5	APN	3	82008588	missense	probably benign	0.02
IGL01908:Asic5	APN	3	82006570	nonsense	probably null
IGL03049:Asic5	APN	3	81996949	unclassified	probably benign
IGL03078:Asic5	APN	3	82014428	missense	possibly damaging	0.65
R0498:Asic5	UTSW	3	82006471	splice site	probably benign
R0517:Asic5	UTSW	3	82009526	missense	probably benign	0.01
R0668:Asic5	UTSW	3	82021001	missense	probably damaging	1.00
R0960:Asic5	UTSW	3	82006540	missense	probably benign	0.04
R0973:Asic5	UTSW	3	82008448	splice site	probably benign
R1061:Asic5	UTSW	3	82021001	missense	probably damaging	1.00
R1106:Asic5	UTSW	3	82004590	missense	probably damaging	1.00
R1703:Asic5	UTSW	3	81999722	missense	possibly damaging	0.75
R1864:Asic5	UTSW	3	82011987	missense	probably benign	0.00
R1892:Asic5	UTSW	3	82020986	missense	probably damaging	1.00
R4629:Asic5	UTSW	3	82006504	missense	probably damaging	1.00
R4736:Asic5	UTSW	3	81999809	missense	possibly damaging	0.56
R5254:Asic5	UTSW	3	82020987	missense	probably damaging	1.00
R5284:Asic5	UTSW	3	82008523	missense	probably damaging	1.00
R5573:Asic5	UTSW	3	82004484	missense	probably benign	0.10
R6163:Asic5	UTSW	3	82006526	missense	probably damaging	1.00
R6359:Asic5	UTSW	3	82004496	missense	possibly damaging	0.87
R6553:Asic5	UTSW	3	82009466	missense	possibly damaging	0.57
R6623:Asic5	UTSW	3	82008585	missense	probably damaging	1.00
R7084:Asic5	UTSW	3	82012011	missense	probably benign	0.00
R7168:Asic5	UTSW	3	82011975	missense	probably damaging	1.00
R7296:Asic5	UTSW	3	82021076	missense	probably benign	0.03
R7304:Asic5	UTSW	3	82009565	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TGGAAGCCACTCATCAAAGGC -3'
(R):5'- AGTAAATGTGGAAACCTGTGCCC -3'

Sequencing Primer
(F):5'- CTCATCAAAGGCTAACAACATGG -3'
(R):5'- GGAAACCTGTGCCCTCTTTCG -3'

Posted On

2019-12-20