Incidental Mutation 'R7885:Asic5'
ID608991
Institutional Source Beutler Lab
Gene Symbol Asic5
Ensembl Gene ENSMUSG00000028008
Gene Nameacid-sensing (proton-gated) ion channel family member 5
SynonymsBLINaC, Accn5, brain-liver-intestine amiloride-sensitive sodium channel
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7885 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location81982290-82021233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82006505 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 204 (Y204F)
Ref Sequence ENSEMBL: ENSMUSP00000029641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029641] [ENSMUST00000107736]
Predicted Effect probably benign
Transcript: ENSMUST00000029641
AA Change: Y204F

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029641
Gene: ENSMUSG00000028008
AA Change: Y204F

DomainStartEndE-ValueType
Pfam:ASC 41 466 3.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107736
AA Change: Y162F

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103364
Gene: ENSMUSG00000028008
AA Change: Y162F

DomainStartEndE-ValueType
Pfam:ASC 1 425 5.5e-110 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the amiloride-sensitive Na+ channel and degenerin (NaC/DEG) family, members of which have been identified in many animal species ranging from the nematode to human. The amiloride-sensitive Na(+) channel encoded by this gene is primarily expressed in the small intestine, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo TCTAT TCTATACTAT 5: 14,714,191 probably null Het
Pclo T TTCTAG 5: 14,714,195 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Pstpip2 C A 18: 77,794,722 T2K probably benign Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Asic5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Asic5 APN 3 82004646 missense possibly damaging 0.48
IGL01155:Asic5 APN 3 82008588 missense probably benign 0.02
IGL01908:Asic5 APN 3 82006570 nonsense probably null
IGL03049:Asic5 APN 3 81996949 unclassified probably benign
IGL03078:Asic5 APN 3 82014428 missense possibly damaging 0.65
R0498:Asic5 UTSW 3 82006471 splice site probably benign
R0517:Asic5 UTSW 3 82009526 missense probably benign 0.01
R0668:Asic5 UTSW 3 82021001 missense probably damaging 1.00
R0960:Asic5 UTSW 3 82006540 missense probably benign 0.04
R0973:Asic5 UTSW 3 82008448 splice site probably benign
R1061:Asic5 UTSW 3 82021001 missense probably damaging 1.00
R1106:Asic5 UTSW 3 82004590 missense probably damaging 1.00
R1703:Asic5 UTSW 3 81999722 missense possibly damaging 0.75
R1864:Asic5 UTSW 3 82011987 missense probably benign 0.00
R1892:Asic5 UTSW 3 82020986 missense probably damaging 1.00
R4629:Asic5 UTSW 3 82006504 missense probably damaging 1.00
R4736:Asic5 UTSW 3 81999809 missense possibly damaging 0.56
R5254:Asic5 UTSW 3 82020987 missense probably damaging 1.00
R5284:Asic5 UTSW 3 82008523 missense probably damaging 1.00
R5573:Asic5 UTSW 3 82004484 missense probably benign 0.10
R6163:Asic5 UTSW 3 82006526 missense probably damaging 1.00
R6359:Asic5 UTSW 3 82004496 missense possibly damaging 0.87
R6553:Asic5 UTSW 3 82009466 missense possibly damaging 0.57
R6623:Asic5 UTSW 3 82008585 missense probably damaging 1.00
R7084:Asic5 UTSW 3 82012011 missense probably benign 0.00
R7168:Asic5 UTSW 3 82011975 missense probably damaging 1.00
R7296:Asic5 UTSW 3 82021076 missense probably benign 0.03
R7304:Asic5 UTSW 3 82009565 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGGAAGCCACTCATCAAAGGC -3'
(R):5'- AGTAAATGTGGAAACCTGTGCCC -3'

Sequencing Primer
(F):5'- CTCATCAAAGGCTAACAACATGG -3'
(R):5'- GGAAACCTGTGCCCTCTTTCG -3'
Posted On2019-12-20