Incidental Mutation 'R7885:Tmem131l'
ID608992
Institutional Source Beutler Lab
Gene Symbol Tmem131l
Ensembl Gene ENSMUSG00000033767
Gene Nametransmembrane 131 like
SynonymsD930015E06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R7885 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location83897655-84040175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83910417 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1259 (K1259E)
Ref Sequence ENSEMBL: ENSMUSP00000141438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052342] [ENSMUST00000191758] [ENSMUST00000192095]
Predicted Effect probably benign
Transcript: ENSMUST00000052342
AA Change: K1258E

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049808
Gene: ENSMUSG00000033767
AA Change: K1258E

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:TMEM131_like 91 174 5.8e-20 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 990 997 N/A INTRINSIC
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1291 1324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191758
AA Change: K1259E

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141438
Gene: ENSMUSG00000033767
AA Change: K1259E

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:DUF3651 155 228 9.2e-10 PFAM
Pfam:DUF3651 285 362 1.5e-9 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 990 997 N/A INTRINSIC
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1291 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192095
AA Change: K1258E

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141607
Gene: ENSMUSG00000033767
AA Change: K1258E

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:DUF3651 155 228 8.8e-10 PFAM
Pfam:DUF3651 285 362 1.4e-9 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 989 996 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo TCTAT TCTATACTAT 5: 14,714,191 probably null Het
Pclo T TTCTAG 5: 14,714,195 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Pstpip2 C A 18: 77,794,722 T2K probably benign Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Tmem131l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tmem131l APN 3 83942500 missense probably damaging 0.99
IGL00777:Tmem131l APN 3 83899290 missense probably damaging 1.00
IGL01400:Tmem131l APN 3 83922122 missense probably damaging 0.99
IGL01642:Tmem131l APN 3 83938050 missense possibly damaging 0.63
IGL01796:Tmem131l APN 3 83938055 nonsense probably null
IGL02055:Tmem131l APN 3 83910366 splice site probably null
IGL02269:Tmem131l APN 3 83938050 missense possibly damaging 0.63
IGL02806:Tmem131l APN 3 83928816 splice site probably benign
IGL03308:Tmem131l APN 3 83940902 missense probably benign 0.00
IGL03345:Tmem131l APN 3 83961589 missense probably damaging 1.00
R0106:Tmem131l UTSW 3 83934815 splice site probably benign
R0112:Tmem131l UTSW 3 83940587 nonsense probably null
R0212:Tmem131l UTSW 3 83913268 missense probably benign 0.19
R0328:Tmem131l UTSW 3 83921931 splice site probably benign
R0412:Tmem131l UTSW 3 84031648 missense probably damaging 1.00
R0544:Tmem131l UTSW 3 83898546 missense probably damaging 1.00
R0676:Tmem131l UTSW 3 83934815 splice site probably benign
R0815:Tmem131l UTSW 3 83940572 missense probably benign 0.01
R0826:Tmem131l UTSW 3 83898417 missense probably damaging 1.00
R1432:Tmem131l UTSW 3 83928714 missense probably damaging 1.00
R1582:Tmem131l UTSW 3 83931783 missense probably damaging 0.99
R1591:Tmem131l UTSW 3 83940889 critical splice donor site probably null
R1804:Tmem131l UTSW 3 83910479 missense possibly damaging 0.72
R1875:Tmem131l UTSW 3 83905076 nonsense probably null
R1955:Tmem131l UTSW 3 83961544 missense probably damaging 1.00
R2049:Tmem131l UTSW 3 83942788 missense probably damaging 1.00
R2125:Tmem131l UTSW 3 83942751 critical splice donor site probably null
R2173:Tmem131l UTSW 3 83926145 missense probably damaging 1.00
R2321:Tmem131l UTSW 3 83936023 missense probably damaging 0.98
R2407:Tmem131l UTSW 3 83922048 missense probably benign 0.25
R2917:Tmem131l UTSW 3 83937580 nonsense probably null
R3082:Tmem131l UTSW 3 83909150 critical splice donor site probably null
R3086:Tmem131l UTSW 3 83931739 missense probably benign 0.00
R3773:Tmem131l UTSW 3 83898586 missense probably damaging 1.00
R3921:Tmem131l UTSW 3 83940601 missense possibly damaging 0.68
R3953:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R3954:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R3956:Tmem131l UTSW 3 83910419 missense probably damaging 1.00
R4118:Tmem131l UTSW 3 83960767 missense probably benign 0.00
R4700:Tmem131l UTSW 3 83899212 missense probably benign
R4862:Tmem131l UTSW 3 83898210 splice site probably benign
R4941:Tmem131l UTSW 3 83899239 missense probably benign 0.03
R5101:Tmem131l UTSW 3 83937504 missense probably damaging 0.96
R5290:Tmem131l UTSW 3 83899265 missense probably benign 0.30
R5501:Tmem131l UTSW 3 83926128 missense probably damaging 1.00
R5813:Tmem131l UTSW 3 83940572 missense probably benign 0.01
R5845:Tmem131l UTSW 3 83940553 missense probably damaging 0.99
R5973:Tmem131l UTSW 3 83922246 missense possibly damaging 0.95
R6119:Tmem131l UTSW 3 83898382 missense probably damaging 1.00
R6241:Tmem131l UTSW 3 83922164 missense probably benign 0.06
R6278:Tmem131l UTSW 3 83942491 missense possibly damaging 0.93
R6490:Tmem131l UTSW 3 83913280 missense possibly damaging 0.67
R6502:Tmem131l UTSW 3 83922408 missense probably damaging 1.00
R6503:Tmem131l UTSW 3 83940944 missense probably benign 0.26
R6868:Tmem131l UTSW 3 83961631 missense probably damaging 0.99
R7104:Tmem131l UTSW 3 83919459 missense possibly damaging 0.68
R7736:Tmem131l UTSW 3 83940568 missense probably damaging 0.97
R8085:Tmem131l UTSW 3 83927131 missense possibly damaging 0.81
Z1177:Tmem131l UTSW 3 84040093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCATGTGCTTTCTGATC -3'
(R):5'- CATCTTTTAGGGACTTGGGGCC -3'

Sequencing Primer
(F):5'- GGGCATGTGCTTTCTGATCTAACC -3'
(R):5'- CTCCCACAGGACTGAGAGAG -3'
Posted On2019-12-20