Incidental Mutation 'R0152:Slc17a3'
ID60900
Institutional Source Beutler Lab
Gene Symbol Slc17a3
Ensembl Gene ENSMUSG00000036083
Gene Namesolute carrier family 17 (sodium phosphate), member 3
SynonymsNpt4
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0152 (G1)
Quality Score164
Status Not validated
Chromosome13
Chromosomal Location23839434-23860716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23855858 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 293 (S293F)
Ref Sequence ENSEMBL: ENSMUSP00000131308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039721] [ENSMUST00000091698] [ENSMUST00000110422] [ENSMUST00000166467]
Predicted Effect probably damaging
Transcript: ENSMUST00000039721
AA Change: S293F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039062
Gene: ENSMUSG00000036083
AA Change: S293F

DomainStartEndE-ValueType
Pfam:MFS_1 45 377 3.3e-46 PFAM
transmembrane domain 393 415 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 459 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091698
AA Change: S215F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089290
Gene: ENSMUSG00000036083
AA Change: S215F

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:MFS_1 95 293 2.8e-25 PFAM
transmembrane domain 310 332 N/A INTRINSIC
transmembrane domain 352 369 N/A INTRINSIC
transmembrane domain 379 398 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110422
AA Change: S257F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106052
Gene: ENSMUSG00000036083
AA Change: S257F

DomainStartEndE-ValueType
Pfam:MFS_1 39 425 6.7e-47 PFAM
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166467
AA Change: S293F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131308
Gene: ENSMUSG00000036083
AA Change: S293F

DomainStartEndE-ValueType
Pfam:MFS_1 9 338 2.3e-46 PFAM
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Meta Mutation Damage Score 0.8156 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a voltage-driven transporter that excretes intracellular urate and organic anions from the blood into renal tubule cells. Two transcript variants encoding different isoforms have been found for this gene. The longer isoform is a plasma membrane protein with transporter activity while the shorter isoform localizes to the endoplasmic reticulum. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Slc17a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Slc17a3 APN 13 23856481 missense probably benign 0.20
IGL02569:Slc17a3 APN 13 23846302 missense probably damaging 1.00
IGL02628:Slc17a3 APN 13 23842451 start codon destroyed probably null 1.00
IGL02745:Slc17a3 APN 13 23842486 missense probably benign 0.01
IGL03001:Slc17a3 APN 13 23856784 missense probably damaging 1.00
IGL03143:Slc17a3 APN 13 23855979 splice site probably null
IGL03144:Slc17a3 APN 13 23846440 missense probably benign 0.00
R0052:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0054:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0131:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0131:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0153:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0233:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0234:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0257:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0294:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0295:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0318:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0319:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0352:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0462:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0610:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0627:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0652:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0765:Slc17a3 UTSW 13 23846896 nonsense probably null
R1529:Slc17a3 UTSW 13 23845445 missense probably damaging 1.00
R1532:Slc17a3 UTSW 13 23856500 missense probably damaging 1.00
R1569:Slc17a3 UTSW 13 23855608 missense probably benign 0.09
R1640:Slc17a3 UTSW 13 23852357 nonsense probably null
R1643:Slc17a3 UTSW 13 23857198 splice site probably benign
R1715:Slc17a3 UTSW 13 23856741 missense probably benign 0.19
R2407:Slc17a3 UTSW 13 23852435 critical splice donor site probably null
R2512:Slc17a3 UTSW 13 23846247 missense probably benign 0.13
R3923:Slc17a3 UTSW 13 23858054 missense possibly damaging 0.89
R4449:Slc17a3 UTSW 13 23856732 missense probably damaging 0.99
R5166:Slc17a3 UTSW 13 23842542 critical splice donor site probably null
R5748:Slc17a3 UTSW 13 23856466 missense probably damaging 1.00
R5989:Slc17a3 UTSW 13 23842428 start gained probably benign
R6281:Slc17a3 UTSW 13 23856799 missense probably benign 0.17
R6811:Slc17a3 UTSW 13 23855941 missense possibly damaging 0.61
R7283:Slc17a3 UTSW 13 23855848 missense
R7341:Slc17a3 UTSW 13 23846884 nonsense probably null
R7467:Slc17a3 UTSW 13 23846967 critical splice donor site probably null
R7485:Slc17a3 UTSW 13 23855849 missense
R8065:Slc17a3 UTSW 13 23858087 missense unknown
Predicted Primers PCR Primer
(F):5'- TGATTTATGATGACCCTGTCTCTCACCC -3'
(R):5'- ACTGTGACAGATGATGCAAACATGAAGA -3'

Sequencing Primer
(F):5'- TCTCTGAACCAACAGGTACATATAAG -3'
(R):5'- TGATGCAAACATGAAGAAGGAATG -3'
Posted On2013-07-24