Incidental Mutation 'R7885:Ptpn12'
ID609000
Institutional Source Beutler Lab
Gene Symbol Ptpn12
Ensembl Gene ENSMUSG00000028771
Gene Nameprotein tyrosine phosphatase, non-receptor type 12
SynonymsP19-PTP, PTP-PEST, PTP-P19
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7885 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location20986645-21055911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 20998525 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 418 (S418R)
Ref Sequence ENSEMBL: ENSMUSP00000030556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030556] [ENSMUST00000151813]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030556
AA Change: S418R

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030556
Gene: ENSMUSG00000028771
AA Change: S418R

DomainStartEndE-ValueType
PTPc 27 295 2.14e-126 SMART
Blast:PTPc 338 399 7e-12 BLAST
low complexity region 499 518 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
low complexity region 622 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151813
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may regulate protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of the oncogene c-ABL and thus may play a role in oncogenesis. This PTP was also shown to interact with, and dephosphorylate, various products related to cytoskeletal structure and cell adhesion, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin. This suggests it has a regulatory role in controlling cell shape and mobility. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality, defective embryo turning, improper somitogenesis and vasculogenesis, impaired liver development, truncation of the caudal region and mesenchyme deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo TCTAT TCTATACTAT 5: 14,714,191 probably null Het
Pclo T TTCTAG 5: 14,714,195 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Pstpip2 C A 18: 77,794,722 T2K probably benign Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Ptpn12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ptpn12 APN 5 21029850 missense probably damaging 1.00
IGL00226:Ptpn12 APN 5 20998668 missense probably damaging 1.00
IGL01432:Ptpn12 APN 5 20998555 nonsense probably null
IGL02285:Ptpn12 APN 5 21055713 missense probably benign 0.40
IGL02488:Ptpn12 APN 5 21022062 missense possibly damaging 0.72
IGL02550:Ptpn12 APN 5 20998139 missense probably benign 0.00
IGL02640:Ptpn12 APN 5 21019246 missense probably damaging 1.00
IGL02652:Ptpn12 APN 5 21002437 missense probably benign 0.04
IGL03130:Ptpn12 APN 5 21002612 unclassified probably benign
R0531:Ptpn12 UTSW 5 20998483 missense possibly damaging 0.53
R0948:Ptpn12 UTSW 5 20998043 missense probably benign
R1018:Ptpn12 UTSW 5 21029869 missense possibly damaging 0.94
R1184:Ptpn12 UTSW 5 20998356 missense possibly damaging 0.86
R1699:Ptpn12 UTSW 5 20998170 missense probably benign 0.01
R1938:Ptpn12 UTSW 5 20993263 missense probably damaging 1.00
R1952:Ptpn12 UTSW 5 20998310 missense probably benign 0.34
R2152:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2153:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2154:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2267:Ptpn12 UTSW 5 20998411 missense probably damaging 0.98
R2358:Ptpn12 UTSW 5 20998692 missense probably damaging 1.00
R3551:Ptpn12 UTSW 5 20989049 missense possibly damaging 0.67
R3931:Ptpn12 UTSW 5 21001323 missense probably benign 0.00
R4013:Ptpn12 UTSW 5 20992743 missense probably benign 0.05
R4039:Ptpn12 UTSW 5 21002510 nonsense probably null
R4501:Ptpn12 UTSW 5 21019280 missense probably damaging 1.00
R4748:Ptpn12 UTSW 5 21005385 nonsense probably null
R4754:Ptpn12 UTSW 5 20998589 missense probably benign 0.34
R4963:Ptpn12 UTSW 5 21015708 splice site probably null
R5160:Ptpn12 UTSW 5 20997831 missense probably damaging 1.00
R5581:Ptpn12 UTSW 5 21015726 missense probably damaging 1.00
R5789:Ptpn12 UTSW 5 20989015 missense possibly damaging 0.92
R5836:Ptpn12 UTSW 5 21009546 nonsense probably null
R6383:Ptpn12 UTSW 5 20987468 nonsense probably null
R6883:Ptpn12 UTSW 5 21055713 missense probably benign 0.40
R7544:Ptpn12 UTSW 5 21009511 missense probably damaging 1.00
R7915:Ptpn12 UTSW 5 21009451 missense probably damaging 1.00
R7960:Ptpn12 UTSW 5 21055689 missense probably benign 0.01
R7976:Ptpn12 UTSW 5 21002633 nonsense probably null
R8032:Ptpn12 UTSW 5 20998043 missense probably benign
R8224:Ptpn12 UTSW 5 20998658 missense probably damaging 1.00
X0004:Ptpn12 UTSW 5 21019296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCTGCACTTAACTCCTG -3'
(R):5'- CCTTGTAGAAGGGGATGCCAAG -3'

Sequencing Primer
(F):5'- CTGCACTTAACTCCTGTGGTTTAGAG -3'
(R):5'- AGAACCTCACCCGGTGC -3'
Posted On2019-12-20