Incidental Mutation 'R7885:Cd19'
ID609007
Institutional Source Beutler Lab
Gene Symbol Cd19
Ensembl Gene ENSMUSG00000030724
Gene NameCD19 antigen
SynonymsAW495831
MMRRC Submission
Accession Numbers

Ncbi Ref Seq: NM_009844.2; MGI: 88319

Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R7885 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location126408450-126414889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126412131 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 294 (T294A)
Ref Sequence ENSEMBL: ENSMUSP00000145803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032968] [ENSMUST00000206325]
Predicted Effect probably benign
Transcript: ENSMUST00000032968
AA Change: T293A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032968
Gene: ENSMUSG00000030724
AA Change: T293A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 23 116 9.12e-7 SMART
low complexity region 139 150 N/A INTRINSIC
IG 182 273 2.41e-6 SMART
transmembrane domain 288 310 N/A INTRINSIC
low complexity region 390 415 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206325
AA Change: T294A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lymphocytes proliferate and differentiate in response to various concentrations of different antigens. The ability of the B cell to respond in a specific, yet sensitive manner to the various antigens is achieved with the use of low-affinity antigen receptors. This gene encodes a cell surface molecule which assembles with the antigen receptor of B lymphocytes in order to decrease the threshold for antigen receptor-dependent stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal B lymphocyte development, activation and differentiation, altered mast cell activation in a model for acute septic peritonitis, inhibition of bleomycin-induced fibrosis and autoantibody production, and increased susceptibility to EAE. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo TCTAT TCTATACTAT 5: 14,714,191 probably null Het
Pclo T TTCTAG 5: 14,714,195 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Pstpip2 C A 18: 77,794,722 T2K probably benign Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Cd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01896:Cd19 APN 7 126414350 missense possibly damaging 0.74
IGL02243:Cd19 APN 7 126410793 splice site probably null
IGL02465:Cd19 APN 7 126413558 missense possibly damaging 0.65
IGL02824:Cd19 APN 7 126410654 missense probably damaging 0.96
IGL03164:Cd19 APN 7 126413509 missense possibly damaging 0.95
Hexagonal UTSW 7 126414306 nonsense probably null
Hive UTSW 7 126412109 missense probably damaging 1.00
R0076:Cd19 UTSW 7 126410862 missense probably damaging 1.00
R0076:Cd19 UTSW 7 126410862 missense probably damaging 1.00
R1147:Cd19 UTSW 7 126411045 missense possibly damaging 0.60
R1147:Cd19 UTSW 7 126411045 missense possibly damaging 0.60
R1860:Cd19 UTSW 7 126409641 missense probably damaging 1.00
R2309:Cd19 UTSW 7 126414275 missense probably benign 0.01
R4422:Cd19 UTSW 7 126413406 missense probably benign 0.31
R4532:Cd19 UTSW 7 126412109 missense probably damaging 1.00
R4649:Cd19 UTSW 7 126414492 missense probably benign 0.00
R5400:Cd19 UTSW 7 126414452 missense probably benign 0.34
R6846:Cd19 UTSW 7 126410853 missense probably benign 0.28
R7027:Cd19 UTSW 7 126410499 missense possibly damaging 0.72
R7226:Cd19 UTSW 7 126414823 missense unknown
R7464:Cd19 UTSW 7 126411803 missense probably damaging 1.00
R7612:Cd19 UTSW 7 126414324 missense possibly damaging 0.87
R7797:Cd19 UTSW 7 126413508 missense probably damaging 1.00
R7869:Cd19 UTSW 7 126410526 missense probably damaging 1.00
R8151:Cd19 UTSW 7 126414306 nonsense probably null
R8317:Cd19 UTSW 7 126413443 nonsense probably null
R8438:Cd19 UTSW 7 126414343 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTGTACAAATACCAGGGACCCC -3'
(R):5'- TCTTCCTTAGTGGACGGGAG -3'

Sequencing Primer
(F):5'- TACCAGGGACCCCAGGAAGTATG -3'
(R):5'- CTTCCTTAGTGGACGGGAGAAGAG -3'
Posted On2019-12-20