Mutagenetix > Incidental Mutations

Incidental Mutation 'R7885:Plat'

609009

Institutional Source

Beutler Lab

Gene Symbol

Plat

Ensembl Gene

ENSMUSG00000031538

Gene Name

plasminogen activator, tissue

Synonyms

t-PA, D8Ertd2e, tPA

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7885 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

22757727-22782844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22771720 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 45 (T45A)

Ref Sequence

ENSEMBL: ENSMUSP00000033941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033941]

Predicted Effect

probably benign
Transcript: ENSMUST00000033941
AA Change: T45A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000033941
Gene: ENSMUSG00000031538
AA Change: T45A

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
FN1	38	80	5.69e-15	SMART
EGF	82	117	4.92e-5	SMART
KR	122	207	3.77e-33	SMART
KR	211	296	4.39e-34	SMART
Tryp_SPc	308	553	6.59e-84	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a key enzyme of the fibrinolytic pathway. The encoded protein undergoes proteolytic processing by plasmin to generate a heterodimeric serine protease that cleaves the proenzyme plasminogen to produce plasmin, a protease that is required to break down fibrin clots. Additionally, the encoded protein is involved in other biological processes such as synaptic plasticity, cell migration and tissue remodeling. Mice lacking the encoded protein display a reduction in long-term potentiation in hippocampus and conversely, transgenic mice overexpressing the encoded protein have increased and prolonged long-term potentiation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal behavior, CNS synpatic transmission, and response to injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,189,314	L608P	probably damaging	Het
Adarb1	A	G	10: 77,295,708	V649A	possibly damaging	Het
Arglu1	C	T	8: 8,667,337	R244H	possibly damaging	Het
Asic5	A	T	3: 82,006,505	Y204F	probably benign	Het
Asz1	A	G	6: 18,104,877	F76S	probably damaging	Het
Bin1	G	A	18: 32,419,843	A174T	probably damaging	Het
Bnipl	A	C	3: 95,250,240	S23A	probably benign	Het
Cd19	T	C	7: 126,412,131	T294A	probably benign	Het
Cdon	G	A	9: 35,456,522	V238I	probably benign	Het
Chd3	A	T	11: 69,356,625	D957E	probably benign	Het
Crhbp	T	C	13: 95,432,007	Q307R	probably damaging	Het
Cst3	A	G	2: 148,872,821	M112T	probably benign	Het
Dgkb	A	G	12: 38,139,426	E276G	probably damaging	Het
Exoc4	T	A	6: 33,758,066	N539K	probably benign	Het
Gm3099	A	G	14: 3,999,461	E85G	probably benign	Het
Gpatch2	A	G	1: 187,225,501		probably null	Het
Hs3st5	T	A	10: 36,828,780	Y26*	probably null	Het
Hspg2	A	T	4: 137,516,837	D802V	probably damaging	Het
Ifih1	A	G	2: 62,601,469	V846A	possibly damaging	Het
Lama4	T	A	10: 39,088,844	S1402T	probably benign	Het
Lrmda	A	G	14: 22,598,320	T73A	unknown	Het
Lrrc1	A	T	9: 77,442,189	V365E	probably damaging	Het
Lrrc37a	T	A	11: 103,503,042	Q519L	probably benign	Het
Mlc1	G	T	15: 88,977,904	D36E	probably benign	Het
Mrc2	A	T	11: 105,332,266	D445V	probably damaging	Het
Muc16	A	G	9: 18,639,464	S5178P	probably benign	Het
Nbea	A	G	3: 55,665,689	I2491T	probably damaging	Het
Ncoa1	A	G	12: 4,339,044	I77T	probably damaging	Het
Npepps	G	T	11: 97,218,648	H701N	probably damaging	Het
Olfr733	T	G	14: 50,298,584	T242P	probably damaging	Het
Olfr837	A	T	9: 19,137,535	I181F	possibly damaging	Het
Pclo	GTCTAT	GTCTATTCTAT	5: 14,714,190		probably null	Het
Pclo	TCTAT	TCTATACTAT	5: 14,714,191		probably null	Het
Pclo	T	TTCTAG	5: 14,714,195		probably null	Het
Pi4kb	T	C	3: 94,999,076	Y645H	probably damaging	Het
Pik3r5	C	T	11: 68,492,702	A449V	possibly damaging	Het
Platr25	T	C	13: 62,700,862	K62R	possibly damaging	Het
Ppp5c	A	G	7: 17,006,186	V410A	possibly damaging	Het
Prdm2	C	T	4: 143,134,570	A717T	probably benign	Het
Pstpip2	C	A	18: 77,794,722	T2K	probably benign	Het
Ptpn12	A	C	5: 20,998,525	S418R	possibly damaging	Het
Rint1	A	G	5: 23,805,644	S255G	probably benign	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Stab2	T	C	10: 86,878,912	H1581R	probably benign	Het
Stau2	T	C	1: 16,460,353	Y114C	unknown	Het
Ticam1	T	C	17: 56,271,067	T343A	probably benign	Het
Tmem131l	T	C	3: 83,910,417	K1259E	possibly damaging	Het
Vmn2r103	T	A	17: 19,793,123	F169I	probably benign	Het
Vps33a	T	C	5: 123,535,249	K425E	possibly damaging	Het
Vwa8	T	C	14: 79,020,649	M746T	probably benign	Het
Zc3hav1	A	G	6: 38,336,663	I149T	possibly damaging	Het
Zfp708	A	T	13: 67,074,129	D62E	probably benign	Het

Other mutations in Plat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Plat	APN	8	22776828	missense	probably benign	0.00
IGL01918:Plat	APN	8	22780437	missense	possibly damaging	0.82
IGL01998:Plat	APN	8	22767147	missense	probably benign	0.31
IGL02978:Plat	APN	8	22776819	missense	probably damaging	1.00
R0829:Plat	UTSW	8	22772257	missense	probably damaging	1.00
R1065:Plat	UTSW	8	22776863	missense	probably damaging	0.99
R2316:Plat	UTSW	8	22776865	missense	probably benign	0.04
R4485:Plat	UTSW	8	22772212	missense	probably benign	0.01
R4873:Plat	UTSW	8	22768450	missense	probably benign	0.03
R4875:Plat	UTSW	8	22768450	missense	probably benign	0.03
R4924:Plat	UTSW	8	22778253	missense	probably damaging	1.00
R5051:Plat	UTSW	8	22773672	missense	probably benign	0.01
R5062:Plat	UTSW	8	22772311	missense	probably benign	0.19
R5402:Plat	UTSW	8	22772722	missense	probably damaging	1.00
R5672:Plat	UTSW	8	22773648	missense	probably benign	0.40
R6306:Plat	UTSW	8	22772266	missense	possibly damaging	0.83
R7035:Plat	UTSW	8	22772311	missense	probably benign	0.32
R7154:Plat	UTSW	8	22778505	missense	possibly damaging	0.76
R7297:Plat	UTSW	8	22775697	missense	probably benign	0.12
R7432:Plat	UTSW	8	22773651	missense	probably damaging	0.99
R7514:Plat	UTSW	8	22775642	missense	probably damaging	1.00
R7679:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R7680:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R7742:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R7834:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R7918:Plat	UTSW	8	22773639	missense	probably damaging	1.00
R8039:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8040:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8243:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8347:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8422:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8423:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8424:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8426:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8427:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8507:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8510:Plat	UTSW	8	22772232	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCACCATATTCCTAAGGGAG -3'
(R):5'- CTGAATAGGCTAGGAACCACG -3'

Sequencing Primer
(F):5'- CCACATCAGTTCAGTACAGGCTTTAG -3'
(R):5'- CCACGGAGGAAGGGTTTG -3'

Posted On

2019-12-20