Incidental Mutation 'R7885:Olfr837'
ID609011
Institutional Source Beutler Lab
Gene Symbol Olfr837
Ensembl Gene ENSMUSG00000110621
Gene Nameolfactory receptor 837
SynonymsGA_x6K02T2PVTD-12873838-12874776, MOR152-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7885 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location19136317-19140641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19137535 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 181 (I181F)
Ref Sequence ENSEMBL: ENSMUSP00000149907 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212482
AA Change: I181F

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215699
AA Change: I181F

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo TCTAT TCTATACTAT 5: 14,714,191 probably null Het
Pclo T TTCTAG 5: 14,714,195 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Pstpip2 C A 18: 77,794,722 T2K probably benign Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Olfr837
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1796:Olfr837 UTSW 9 19137917 missense probably benign
R5244:Olfr837 UTSW 9 19137851 missense probably damaging 1.00
R5918:Olfr837 UTSW 9 19137388 missense probably damaging 1.00
R6023:Olfr837 UTSW 9 19137725 missense probably damaging 1.00
R6472:Olfr837 UTSW 9 19137415 missense probably damaging 0.99
R6746:Olfr837 UTSW 9 19137478 missense probably benign 0.38
R7514:Olfr837 UTSW 9 19137865 missense possibly damaging 0.47
R7891:Olfr837 UTSW 9 19137845 missense possibly damaging 0.75
R8117:Olfr837 UTSW 9 19137057 missense probably benign 0.09
R8121:Olfr837 UTSW 9 19137692 missense probably damaging 1.00
R8203:Olfr837 UTSW 9 19137874 missense probably damaging 1.00
Z1177:Olfr837 UTSW 9 19137102 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTGAGCCAGGGATGCTTTG -3'
(R):5'- CCCACAAGTAGAGAAGGCTTTATAC -3'

Sequencing Primer
(F):5'- CCTTGGAATAATGGCCTATGACCG -3'
(R):5'- GAGAAGGCTTTATACTTTCCTTCTG -3'
Posted On2019-12-20