Mutagenetix > Incidental Mutations

Incidental Mutation 'R7885:Sltm'

609013

Institutional Source

Beutler Lab

Gene Symbol

Sltm

Ensembl Gene

ENSMUSG00000032212

Gene Name

SAFB-like, transcription modulator

Synonyms

9130215G10Rik, 5730555F13Rik, 5730455C01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R7885 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70542754-70592234 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 70586673 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Arginine at position 802 (P802R)

Ref Sequence

ENSEMBL: ENSMUSP00000049112 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000216816] [ENSMUST00000217593]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049263
AA Change: P802R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: P802R

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
SAP	22	56	2.49e-10	SMART
low complexity region	74	86	N/A	INTRINSIC
coiled coil region	152	180	N/A	INTRINSIC
low complexity region	318	330	N/A	INTRINSIC
low complexity region	352	384	N/A	INTRINSIC
RRM	385	458	2.06e-16	SMART
low complexity region	498	526	N/A	INTRINSIC
low complexity region	536	552	N/A	INTRINSIC
low complexity region	591	601	N/A	INTRINSIC
coiled coil region	635	727	N/A	INTRINSIC
low complexity region	824	853	N/A	INTRINSIC
low complexity region	979	990	N/A	INTRINSIC
low complexity region	1015	1028	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000216816
AA Change: P784R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000217593

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,189,314	L608P	probably damaging	Het
Adarb1	A	G	10: 77,295,708	V649A	possibly damaging	Het
Arglu1	C	T	8: 8,667,337	R244H	possibly damaging	Het
Asic5	A	T	3: 82,006,505	Y204F	probably benign	Het
Asz1	A	G	6: 18,104,877	F76S	probably damaging	Het
Bin1	G	A	18: 32,419,843	A174T	probably damaging	Het
Bnipl	A	C	3: 95,250,240	S23A	probably benign	Het
Cd19	T	C	7: 126,412,131	T294A	probably benign	Het
Cdon	G	A	9: 35,456,522	V238I	probably benign	Het
Chd3	A	T	11: 69,356,625	D957E	probably benign	Het
Crhbp	T	C	13: 95,432,007	Q307R	probably damaging	Het
Cst3	A	G	2: 148,872,821	M112T	probably benign	Het
Dgkb	A	G	12: 38,139,426	E276G	probably damaging	Het
Exoc4	T	A	6: 33,758,066	N539K	probably benign	Het
Gm3099	A	G	14: 3,999,461	E85G	probably benign	Het
Gpatch2	A	G	1: 187,225,501		probably null	Het
Hs3st5	T	A	10: 36,828,780	Y26*	probably null	Het
Hspg2	A	T	4: 137,516,837	D802V	probably damaging	Het
Ifih1	A	G	2: 62,601,469	V846A	possibly damaging	Het
Lama4	T	A	10: 39,088,844	S1402T	probably benign	Het
Lrmda	A	G	14: 22,598,320	T73A	unknown	Het
Lrrc1	A	T	9: 77,442,189	V365E	probably damaging	Het
Lrrc37a	T	A	11: 103,503,042	Q519L	probably benign	Het
Mlc1	G	T	15: 88,977,904	D36E	probably benign	Het
Mrc2	A	T	11: 105,332,266	D445V	probably damaging	Het
Muc16	A	G	9: 18,639,464	S5178P	probably benign	Het
Nbea	A	G	3: 55,665,689	I2491T	probably damaging	Het
Ncoa1	A	G	12: 4,339,044	I77T	probably damaging	Het
Npepps	G	T	11: 97,218,648	H701N	probably damaging	Het
Olfr733	T	G	14: 50,298,584	T242P	probably damaging	Het
Olfr837	A	T	9: 19,137,535	I181F	possibly damaging	Het
Pclo	GTCTAT	GTCTATTCTAT	5: 14,714,190		probably null	Het
Pclo	TCTAT	TCTATACTAT	5: 14,714,191		probably null	Het
Pclo	T	TTCTAG	5: 14,714,195		probably null	Het
Pi4kb	T	C	3: 94,999,076	Y645H	probably damaging	Het
Pik3r5	C	T	11: 68,492,702	A449V	possibly damaging	Het
Plat	A	G	8: 22,771,720	T45A	probably benign	Het
Platr25	T	C	13: 62,700,862	K62R	possibly damaging	Het
Ppp5c	A	G	7: 17,006,186	V410A	possibly damaging	Het
Prdm2	C	T	4: 143,134,570	A717T	probably benign	Het
Pstpip2	C	A	18: 77,794,722	T2K	probably benign	Het
Ptpn12	A	C	5: 20,998,525	S418R	possibly damaging	Het
Rint1	A	G	5: 23,805,644	S255G	probably benign	Het
Stab2	T	C	10: 86,878,912	H1581R	probably benign	Het
Stau2	T	C	1: 16,460,353	Y114C	unknown	Het
Ticam1	T	C	17: 56,271,067	T343A	probably benign	Het
Tmem131l	T	C	3: 83,910,417	K1259E	possibly damaging	Het
Vmn2r103	T	A	17: 19,793,123	F169I	probably benign	Het
Vps33a	T	C	5: 123,535,249	K425E	possibly damaging	Het
Vwa8	T	C	14: 79,020,649	M746T	probably benign	Het
Zc3hav1	A	G	6: 38,336,663	I149T	possibly damaging	Het
Zfp708	A	T	13: 67,074,129	D62E	probably benign	Het

Other mutations in Sltm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00577:Sltm	APN	9	70579342	missense	probably damaging	1.00
IGL01755:Sltm	APN	9	70583922	splice site	probably null
IGL01782:Sltm	APN	9	70573641	missense	probably damaging	1.00
IGL02441:Sltm	APN	9	70587185	missense	probably damaging	1.00
IGL02831:Sltm	APN	9	70584865	missense	probably damaging	1.00
IGL02947:Sltm	APN	9	70591664	missense	probably benign	0.05
IGL03166:Sltm	APN	9	70542969	missense	possibly damaging	0.87
R0288:Sltm	UTSW	9	70579351	missense	probably damaging	1.00
R0555:Sltm	UTSW	9	70586081	missense	probably damaging	1.00
R0815:Sltm	UTSW	9	70561908	missense	probably benign	0.04
R0863:Sltm	UTSW	9	70561908	missense	probably benign	0.04
R1315:Sltm	UTSW	9	70543065	missense	probably benign	0.13
R1533:Sltm	UTSW	9	70586666	missense	probably damaging	1.00
R1676:Sltm	UTSW	9	70573647	missense	probably damaging	1.00
R1764:Sltm	UTSW	9	70561800	missense	probably benign	0.00
R1845:Sltm	UTSW	9	70543032	missense	possibly damaging	0.60
R2049:Sltm	UTSW	9	70581301	missense	probably benign	0.00
R2163:Sltm	UTSW	9	70591682	missense	probably damaging	0.99
R3410:Sltm	UTSW	9	70585958	missense	probably damaging	0.97
R4323:Sltm	UTSW	9	70580247	missense	probably benign
R4632:Sltm	UTSW	9	70579369	missense	possibly damaging	0.86
R4748:Sltm	UTSW	9	70581365	missense	probably damaging	1.00
R4756:Sltm	UTSW	9	70591610	missense	possibly damaging	0.57
R4782:Sltm	UTSW	9	70589057	missense	probably damaging	1.00
R4799:Sltm	UTSW	9	70589057	missense	probably damaging	1.00
R4887:Sltm	UTSW	9	70588978	missense	probably damaging	1.00
R5221:Sltm	UTSW	9	70579403	missense	probably damaging	1.00
R5263:Sltm	UTSW	9	70584799	missense	unknown
R5982:Sltm	UTSW	9	70586804	missense	probably damaging	1.00
R6297:Sltm	UTSW	9	70581359	missense	probably damaging	0.99
R6456:Sltm	UTSW	9	70542987	missense	probably damaging	1.00
R6658:Sltm	UTSW	9	70581362	missense	probably damaging	1.00
R6720:Sltm	UTSW	9	70573710	missense	probably damaging	1.00
R6770:Sltm	UTSW	9	70584777	missense	unknown
R6923:Sltm	UTSW	9	70574610	missense	probably damaging	1.00
R7051:Sltm	UTSW	9	70559066	missense	probably damaging	1.00
R7166:Sltm	UTSW	9	70584850	missense	probably damaging	1.00
R7257:Sltm	UTSW	9	70543965	splice site	probably null
R7400:Sltm	UTSW	9	70586070	missense	probably damaging	1.00
R7438:Sltm	UTSW	9	70573466	missense	unknown
R7484:Sltm	UTSW	9	70573897	missense	unknown
R7630:Sltm	UTSW	9	70586673	missense	possibly damaging	0.94
R7631:Sltm	UTSW	9	70586673	missense	possibly damaging	0.94
R7632:Sltm	UTSW	9	70586673	missense	possibly damaging	0.94
R7633:Sltm	UTSW	9	70586673	missense	possibly damaging	0.94
R7862:Sltm	UTSW	9	70572164	nonsense	probably null
R7886:Sltm	UTSW	9	70586673	missense	possibly damaging	0.94
R7888:Sltm	UTSW	9	70586673	missense	possibly damaging	0.94
R7889:Sltm	UTSW	9	70586673	missense	possibly damaging	0.94
R7891:Sltm	UTSW	9	70586673	missense	possibly damaging	0.94
R7915:Sltm	UTSW	9	70587149	missense	probably damaging	1.00
R8030:Sltm	UTSW	9	70585979	nonsense	probably null
R8062:Sltm	UTSW	9	70573497	missense	unknown
R8099:Sltm	UTSW	9	70586078	missense	probably damaging	1.00
R8374:Sltm	UTSW	9	70561945	missense	probably null

Predicted Primers

PCR Primer
(F):5'- TAATGAGGGCTTTTCTGGCAGC -3'
(R):5'- TGGTCTAGAAGGATTGGGCAC -3'

Sequencing Primer
(F):5'- GCCTTGCCATAATTTCCCTTAAAAG -3'
(R):5'- CTAGAAGGATTGGGCACAGTCTCTC -3'

Posted On

2019-12-20